Quantum interference between single photons from a single atom and a cold atomic ensemble

... To trap a single atom, we start with an atomic cloud in a magneto-optical trap (MOT) and use an optical dipole trap to trap a single atom at the focus of the lens1 A MOT consists of three pairs ... my stay enjoyable To all my family members, especially my parents, that are always there and have always cared for me No words can express my gratitude to all of you At last, m...

Ngày tải lên: 30/09/2015, 10:11

... work with him and Sandako while doing HOM measurements Gleb, for always teasing me I still miss that Dzmitry, for his great ideas One can approach him anytime and any day and he is always ready ... residual pump light The pump beams can be adjusted to any value from a linear to circular polarization using Polarizers (P), quarter wave plates (q) A pair of quarter wave plates (q), h...

Ngày tải lên: 09/09/2015, 08:15

... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method d...

Ngày tải lên: 14/12/2013, 18:16

... plasma and CSF HIV-1 RNA levels The subject was placed on a highly active antiretroviral therapy (HAART) regimen of abacavir, nevirapine and zidovidine in January 1999, which suppressed plasma and ... to as "late" isolates (designated "E" and "L", respectively) Replication kinetics We first examined the capacity of the HIV-1 isolates to replicate in PHA-activated PBMC (Fig 1...

Ngày tải lên: 18/06/2014, 18:20

... perturbation (BNp) is a Boolean network altered so that, at any moment t, there is a probability P of randomly flipping a variable of the current state x(t) of the BN An ordinary BN possesses a stationary ... typical in statistical inference For instance, point estimation of the mean of a distribution identifies a single value as the candidate for the mean, and typ...

Ngày tải lên: 22/06/2014, 19:20

... surgical treatment for pulmonary metastases from esophageal carcinoma A major characteristic of this article is that the primary treatment for esophageal carcinoma was confined to definitive CRT, and ... for pulmonary metastases from esophageal carcinoma In this article, we report our institutional experience with surgical treatment for pulmonary...

Ngày tải lên: 10/08/2014, 09:22

... http://www.biomedcentral.com/147 1-2 44X/11/25/prepub doi:10.1186/147 1-2 44X-1 1-2 5 Cite this article as: Langås et al.: Comorbid mental disorders in substance users from a single catchment area - a clinical study BMC Psychiatry 2011 11:25 ... sensitivity Br J Psychiatry 1978, 133:42 9-4 35 103 Favre S, Aubry JM, Gex-Fabry M, Ragama-Pardos E, McQuillan...

Ngày tải lên: 11/08/2014, 16:23

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTC...

Ngày tải lên: 12/08/2014, 03:20

... this article as: Altenbach et al.: Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin ... the gamma gliadin protein families and sequence redundancy within the databases, peptide data were further inspected manually For each protei...

Ngày tải lên: 12/08/2014, 03:21

... infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection ... infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed...

Ngày tải lên: 12/08/2014, 16:20

... examined evolution of the viral nef genes from a single transmitted strain Nef, a small accessory protein, was selected because the virus can tolerate significant variability in the nef protein, ... genes in parallel with mathematical/computational modeling [1-3] Major goals of such analyses include the characterization of the transmitted strains, estimating the timing of...

Ngày tải lên: 12/08/2014, 23:21

... Therefore, a broad range of viruses circulating in a single donor may be potentially transmissible at any one time, consistent Page of 14 with the hypothesis that transmission of viral variants is a random ... gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA P2 gp120 day 63 SGA 10 P2...

Ngày tải lên: 13/08/2014, 01:21

... focused on the secondary prevention of stroke with APS, and compared single antiplatelet therapy and a combination of antiplatelet and anticoagulation therapy in ischemic stroke patients with APS The ... Int J Med Sci 2010, with APS We therefore compared single antiplatelet therapy and a combination of antiplatelet and anticoagulati...

Ngày tải lên: 26/10/2012, 09:48

... interactions between skeletal muscle TnC( 1–91) and TnI( 98–182), we have constructed two single chain chimeras composed of these domains The chimeras were formed by residues 1–91 of TnC and residues ... the TnC( 1–91) and TnI( 98–182) form a regulatory subunit, and that the first half of the C terminus of TnI is important for this binding Structural inf...

Ngày tải lên: 16/03/2014, 18:20