2  passing single data values to and from a function

... components that store or handle data are often two-state devices This is like a switch that can be on or off A memory unit could exist in two voltage states, high or low A voltage on a cable could ... A light could be on or off Two states can be coded by binary and 3-Dec-09 quangkien@gmail.com 7 Why am I learning about binary? l l l In your Cisco course, you will learn about IP addresses and ... have left Can you take from 9? Yes Put under What is left? – = 3-Dec-09 quangkien@gmail.com 19 19 Convert 185 decimal to binary Value 128 64 32 16 Binary 1 1 Check Wwe have left Can you take from...

Ngày tải lên: 24/03/2014, 11:20

Ngày tải lên: 07/07/2014, 12:20

... randomized trial, analysis and interpretation of the data, and manuscript preparation MS and DV conducted data analysis and participated in data interpretation and manuscript preparation All authors ... com- Page of puter-generated, design adaptive allocation to balance seven variables across groups (see Statistical analysis) Allocation was concealed from all personnel prior to randomization ... care of cervicogenic headache [11,13] Spinal manipulation had a clinically important advantage over light massage in headache pain, number, and disability; there was little effect of dose A path...

Ngày tải lên: 13/08/2014, 14:20

... and time intervals is not one that I have looked into very far, but it would seem to be primarily a database rather than a linguistic issue, and to highlight the limitations of traditional databases, ... cities of the Scandinavian countries linked by rail?" In cases involving aggregate operators such as "total" and "average", an indexed set is clearly needed, and Chat handles these cases correctly ... NL access If the database does not easily support the kind of NL queries the user wants to ask, it is probably not a well-deslgned database In general it seems best to design a database so that...

Ngày tải lên: 21/02/2014, 20:20

... K Lahiri and P Das, “I and I ∗ -convergence in topological spaces,” Mathematica Bohemica, vol 130, no 2, pp 153–160, 2005 ˇ a P Kostyrko, M Maˇ aj, T Sal´ t, and M Sleziak, “I-convergence and ... 2009 8 Journal of Inequalities and Applications 10 M Gurdal, A Sahiner, and I Acık, “Approximation theory in 2-Banach spaces,” Nonlinear Analysis: ¸ ¸ ¨ Theory, Methods & Applications, vol 71, ... Freese and Y J Cho, Geometry of Linear 2-Normed Spaces, Nova Science, Hauppauge, NY, USA, 2001 A Sahiner, M Gurdal, S Saltan, and H Gunawan, “Ideal convergence in 2-normed spaces,” Taiwanese ¸...

Ngày tải lên: 21/06/2014, 07:20

... today most advantages don’t stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another ... She added another value: that many women care about social issues and will patronize a company that cares.19 Greg Carpenter and Kent Nakamoto have challenged a core assumption of marketers that ... manufacturer Caterpillar’s brand personality triggers such associations as hardworking, resilient, tough, bold, and determined So Caterpillar has been able to launch Cat jeans, sandals, sunglasses,...

Ngày tải lên: 24/10/2013, 08:20

... reactions are performed as reported in Materials and methods SDS/PAGE was carried out on a 12.5% acrylamide gel and then stained with Coomassie blue Molecular mass markers (lane 1), actin alone (lane ... Essential regulators of actin dynamics Ann Rev Cell Dev Biol 15, 185–230 Hatanaka, H., Ogura, K., Moriyama, M., Ichikawa, S., Yahara, I & Inagaki, F (1996) Tertiary structure of destrin and structural ... using alkaline phosphatase-labelled anti-IgG antibodies (1 : 1000) or alkaline phosphatase-labelled streptavidin (1 : 1000) Control assays were carried out in wells saturated with gelatin and gelatin...

Ngày tải lên: 22/02/2014, 07:20

... In particular, it was shown that a change in the energy state of mitochondria can lead to modulation of the shape of Ca2+ oscillations and waves, which are generated by autocatalytic release ... local excitation can spread through the cell as a concentration wave, which appears to be propagated by Ca2+ diffusion and CICR In hepatocytes, periodic Ca2+ waves are seen that originate from a ... have been developed to analyse stationary states Some of these tools are applicable also to oscillatory systems as long as average fluxes are considered, because for these, the stationary balance...

Ngày tải lên: 24/03/2014, 00:21

... spectrophotometer and the absorbance was monitored at 422 and 390 nm, and the difference taken Ca2+-binding to the ATPase was measured using the dual labeling technique of Longland et al [13] ATPase (0.1 ... purchased from Sigma [c-32P]ATP was obtained from Amersham Vector plasmids containing both wild-type and mutant cDNA for the rabbit skeletal muscle SR Ca2+ ATPase (SERCA 1) were received as a gift ... and RASTER3D software packages [29] TNP-ADP binding to Ca2+-ATPase Tryptophan fluorescence to follow Ca2+-induced conformational changes The conformational change induced by addition of Ca2+ to...

Ngày tải lên: 31/03/2014, 23:20

... calculated as the ratio of total leaf area to total plant dry mass; specific leaf area, SLA (m g as the ratio of -1 ), total leaf area to leaf dry mass; partitioning of total plant ), -1 dry mass, ... September all plants were harvested and were separated into leaves, all the stem, and coarse (> mm) and fine (< mm) roots Surface area of each leaf and total foliage area of each seedling were measured ... extracts and comparing changes in absorbance measured for the standards and those caused by the treatment 2.6 Statistical analysis Individual measurements were averaged per plant, and plants measured...

Ngày tải lên: 08/08/2014, 14:21

... quantitative and the categorical variates Finally, procedures are illustrated with a data set pertaining to calving difficulty (categorical), birth weight and pelvic opening a method of approach; ... general aspects Suppose the available data pertain to three random variables: two quantitative (e.g., calf’s birth weight and dam’s pelvic opening) and one binary (e.g., easy vs difficult calving) ... survival, may be a non-linear function of genetic and non-genetic variables (sire, breed, herd-year) and may also depend on quantitative response variates A possible course of action in the analysis...

Ngày tải lên: 09/08/2014, 22:23

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT...

Ngày tải lên: 12/08/2014, 03:20

... sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in ... analyses and contributed to experimental design All authors analyzed MS/MS data and have read and approved the final manuscript Received: 25 July 2009 Accepted: 11 January 2010 Published: 11 January ... the gamma gliadin protein families and sequence redundancy within the databases, peptide data were further inspected manually For each protein band, individual gamma gliadin peptides obtained from...

Ngày tải lên: 12/08/2014, 03:21

... to have were to was to have was to 10 was to have 56 Exercise 2: will … have to had to don‟t have to don‟t have to- don‟t have to has to have to have to have to don‟t have to 10 don‟t have to ... realized that the mastering of modals especially appear to be unsatisfactory due to the structural approach to grammar teaching Learners learn the meanings of modals as a list and usually fail to understand ... in detail Then the correct meaning and functions of English and Vietnamese modals and semi- modals are made out Students can learn the appropriate usages of modals and semi- modals and apply...

Ngày tải lên: 02/03/2015, 14:30

... VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POSTGRADUATE STUDIES  MAI THI ̣ VÂN ANH “BE TO AND “HAVE TO + LEXICAL VERBS AND THEIR MODAL ... Modality and Modulation Table 3: Semi- modality distinction Table 4: The auxiliary verb- main verb gradient Table 5: Variant forms of the lexical verb be Table 6: Variant forms of have Table 7: ... expressed by „be to and „have to 22 2.1.1 Conventional meanings of „be to 22 2.1.2 Conventional meanings of “have to 23 2.1.3 „Be to , „have to and the semantic blend between...

Ngày tải lên: 02/03/2015, 14:30

... the aimed evolutionary beneficial character of anxiety to serve and protect and to increase the survival chances has been lost In humans and rodents, limbic and cortical areas as the amygdala, ... Hypothetical model of calcium channel inactivation 96 Figure 39: Idealized steady-state activation/inactivation kinetics 99 VII ABBREVIATIONS Abbreviations AD/DA ATP+ fA nA pA ANOVA AV BaCl2 bp BLAST ... incorporated into the plasma membrane by its various transmembrane segments Adopted from (Arikkath and Campbell, 2003) Owing to the pharmacologically distinct character of CaV1.2 in human physiology,...

Ngày tải lên: 08/09/2015, 19:30

... today most advantages don’t stay relevant and few are sustainable Advantages are temporary Increasingly, a company wins not with a single advantage but by layering one advantage on top of another ... United States, Madonna, and you—yes, you! A brand is any label that carries meaning and associations A great brand does more: It lends coloration and resonance to a product or service Russell Hanlin, ... customized equipment such as B-47s or power plants or selling to large national and global accounts Today’s companies increasingly assign national and global account managers to manage their largest...

Ngày tải lên: 21/09/2012, 17:33

... United States, Madonna, and you—yes, you! A brand is any label that carries meaning and associations A great brand does more: It lends coloration and resonance to a product or service Russell Hanlin, ... customized equipment such as B-47s or power plants or selling to large national and global accounts Today’s companies increasingly assign national and global account managers to manage their largest ... votes Great brands are the only route to sustained, above-average profitability And great brands present emotional benefits, not just rational benefits Too many brand managers focus on rational incentives...

Ngày tải lên: 24/10/2013, 08:20

... Marketing Insights from A to Z • From mass marketing to customized marketing The mass market is splintering into mini-markets and your company now has the capability of marketing to one customer ... recruiting, training, exchanging, and communicating • From single- channel marketing to multichannel marketing Companies no longer rely on one channel to reach and serve all their customers Their customers ... salesperson can convince you about the virtues of a product as persuasively as can a friend, acquaintance, past customer, or independent expert Suppose you are planning to buy a PDA (personal digital assistant)...

Ngày tải lên: 24/10/2013, 08:20

... surprises and delights can a company create? Interesting question! atabase Marketing At the heart of CRM is database marketing Your company needs to develop separate databases on customers, employees, ... this year but in your share of the customer’s mind and heart Companies that make steady gains in mind share and heart share will inevitably make gains in market share and profitability Marketing ... will Companies must view the customer as a financial asset that needs to be managed and maximized like any other asset Tom Peters sees customers as an “appreciating asset.” They are the company’s...

Ngày tải lên: 24/10/2013, 08:20