5 import data from a single data file
báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt
Ngày tải lên :
12/08/2014, 03:21
... evidence from current EST data that the other seven gamma gliadin variants are expressed Identification of Butte 86 gamma gliadins by MS/MS Because neither the NCBI database nor any single EST assembly ... the gamma gliadin protein families and sequence redundancy within the databases, peptide data were further inspected manually For each protein band, individual gamma gliadin peptides obtained from ... sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in...
- 14
- 325
- 0
Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx
Ngày tải lên :
18/06/2014, 18:20
... demonstrated major variants in C18L that were distinct from a single variant present in C18E; major variants in C98L that were distinct from a single major variant present in C98E; and major variants ... placed on a highly active antiretroviral therapy (HAART) regimen of abacavir, nevirapine and zidovidine in January 1999, which suppressed plasma and CSF viral loads to below detectable levels and ... Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Ogawa Y, Meguro K, Fujino M: A small-molecule, nonpeptide CCR5 antagonist with highly potent and...
- 12
- 401
- 0
Báo cáo hóa học: " Research Article Inference of a Probabilistic Boolean Network from a Single Observed Temporal Sequence" potx
Ngày tải lên :
22/06/2014, 19:20
... Boolean reduction The task is facilitated by treating one variable at a time Given any variable, xi , and keeping in mind that some observed state transitions arise from random perturbations rather ... strategy, a set of 20 data sequences, each consisting of 100 000 samples points, was generated from a PBN consisting of BNs, n = variables, k = 2, P = 01, and q = 001 in database A We define a sampling ... the temporal data sequence results from a BN without perturbations, then a given state will always be followed by a unique state at the next time point, and each row of matrix C contains at most...
- 15
- 402
- 0
Báo cáo y học: "Surgical treatment for pulmonary metastases from esophageal carcinoma after definitive chemoradiotherapy: Experience from a single institution" doc
Ngày tải lên :
10/08/2014, 09:22
... esophageal carcinoma Interact Cardiovasc Thorac Surg 2008, 7:809-812 Shiono S, Kawamura M, Sato T, Nakagawa K, Nakajima J, Yoshino I, Ikeda N, Horio H, Akiyama H, Kobayashi K: Disease-free interval ... indicated that solitary pulmonary metastasis from esophageal carcinoma was a favorable indicator for surgical treatment [6] In this article, patients with solitary pulmonary metastasis also showed ... 57:425-433 13 Nakamura T, Hayashi K, Ota M, Eguchi R, Ide H, Takasaki K, Mitsuhashi N: Salvage esophagectomy after definitive chemotherapy and radiotherapy for advanced esophageal cancer Am J Surg...
- 6
- 498
- 0
Báo cáo y học: " Comorbid mental disorders in substance users from a single catchment area - a clinical study" potx
Ngày tải lên :
11/08/2014, 16:23
... disorder; APA: American Psychiatric Association; AUDIT: Alcohol Use Disorder Identification Test; BRAIN: Bipolar Research and Innovation Network; DSM-IV: Diagnostic and Statistical Manual of Mental ... Meyer DA: A rating scale for mania: reliability, validity and sensitivity Br J Psychiatry 1978, 133:429-435 103 Favre S, Aubry JM, Gex-Fabry M, Ragama-Pardos E, McQuillan A, Bertschy G: [Translation ... [25 refs] 96 Maffei C, Fossati A, Agostoni I, Barraco A, Bagnato M, Deborah D, Namia C, Novella L, Petrachi M: Interrater reliability and internal consistency of the structured clinical interview...
- 12
- 523
- 0
Báo cáo y học: "Nef gene evolution from a single transmitted strain in acute SIV infection" ppt
Ngày tải lên :
12/08/2014, 23:21
... Institutional Animal Care and Use Committee, and the NIH Viral RNA isolation and cDNA synthesis Viral RNA was isolated from each animal at defined time points following infection Cell-free plasma was ... injection Animal r00098 (r98) was infected by intrarectal inoculation with 10 MID50 SIVmac239 Viral RNA was isolated from frozen plasma samples from animal r00065 collected at days 4, 7, 11, and 18 ... approach was used for all amplifications The following primers designed to amplify a region of the viral Nef gene were used for the first round of PCR: 5'-CAAAGAAGGAGACGGTGGAG-3' and 5'-CATCAAGAAAGTGGGCGTTC-3'...
- 13
- 201
- 0
Báo cáo y học: " Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants" docx
Ngày tải lên :
13/08/2014, 01:21
... Naidoo) Uganda: MRC/Uganda Virus Research Institute, Entebbe (H Grosskurth, A Kamali, P Kaleebu, J Mugisha, U Bahemuka, F Lyagoba, P Tabuga) Spain: Hospital Clinic-IDIBAPS Univ of Barcelona Barcelona ... g/ml streptavidin-conjugated alkaline phosphatase (ALP; Mabtech, Sweden) was added The plate was incubated at room temperature for 40 The streptavidinALP was then discarded and the plate washed seven ... Trial Physician Sarah Fidler Trial Statistician Abdel Babiker Data and Safety Monitoring Committee A McLaren (in memoriam), V Beral, G Chene, J Hakim Central Virology Laboratories and Repositories...
- 14
- 360
- 0
Quantum interference between single photons from a single atom and a cold atomic ensemble
Ngày tải lên :
30/09/2015, 10:11
... my stay enjoyable To all my family members, especially my parents, that are always there and have always cared for me No words can express my gratitude to all of you At last, many thanks to all ... To trap a single atom, we start with an atomic cloud in a magneto-optical trap (MOT) and use an optical dipole trap to trap a single atom at the focus of the lens1 A MOT consists of three pairs ... is fairly complicated that involves the filtering of the optical sideband from an electro-optic phase modulator Another method to excite the atom is through adiabatic rapid passage (ARP) via chirped...
- 90
- 394
- 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot
Ngày tải lên :
12/08/2014, 03:20
... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT...
- 10
- 250
- 0
Tài liệu Module 1: Displaying Data from a Database docx
Ngày tải lên :
11/12/2013, 14:15
... Displaying Data from a Database Database Architecture Slide Objective To provide an overview of database architecture Lead-in A database is a collection of data that you can sort, search, add ... to a database A site that enables users to search, retrieve, and update data in a database is a data- driven Web site As a result of the enhanced functionality that data- driven Web sites bring about, ... FirstName="John" AND LastName="Smith" A relational database is a collection of related tables from which data can be accessed To access data in relational databases, you use structured query language...
- 40
- 540
- 0
Tài liệu Module 1: Displaying Data from a Database ppt
Ngày tải lên :
21/12/2013, 19:15
... Displaying Data from a Database Database Architecture Slide Objective To provide an overview of database architecture Lead-in A database is a collection of data that you can sort, search, add ... to a database A site that enables users to search, retrieve, and update data in a database is a data- driven Web site As a result of the enhanced functionality that data- driven Web sites bring about, ... FirstName="John" AND LastName="Smith" A relational database is a collection of related tables from which data can be accessed To access data in relational databases, you use structured query language...
- 40
- 451
- 0
Tài liệu Updating a Data Source with Data from a Different Data Source doc
Ngày tải lên :
21/01/2014, 11:20
... tracks changes made to data by maintaining multiple versions of each row allowing the data to be reconciled later to a data source using a DataAdapter The data source to which the DataSet is reconciled ... destination DataAdapter is called using the DataSet containing the changes as the data object argument; this applies the changes to the destination data source The destination DataSet is then cleared ... { // Create a DataSet of the added, modified, and deleted records DataSet dsDelta = dsSource.GetChanges(DataRowState.Added | DataRowState.Modified | DataRowState.Deleted); if (dsDelta != null)...
- 4
- 326
- 0
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt
Ngày tải lên :
21/01/2014, 12:20
... Private Sub Page_Load(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles MyBase.Load 'Put user code to initialize the page here Dim odaProdIndiv As OleDb.OleDbDataAdapter odaProdIndiv ... First Page of This How-To Object Property OleDbDataAdapter ID Setting odaProducts SelectCommand SELECT ProductID, ProductName FROM Products DataSet ID dsProducts DataGrid dgProducts DataSource ... DataKeyField ProductID DataMember Products ID hplReturnToMain NavigateURL HyperLink ID wfrmMain.aspx Right-click on the DataGrid control and choose Property Builder Click on the Columns tab and...
- 5
- 392
- 0
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc
Ngày tải lên :
22/03/2014, 18:20
... unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a three-latent class ... Table compares estimates for Se, Spe and prevalence obtained by bivariate analysis with culture and composite reference standard and by the LCA approach Most values are similar, only the prevalence ... standards Both a latent class and a composite reference standard approach suggested that the prevalence of TB in this group of patients was approximately 44%, and thus a relative 16% higher than...
- 7
- 506
- 0
Turbulent diffusion from a point source, laboratory data
Ngày tải lên :
18/05/2014, 19:36
... horizontal rake $ xW, y/k and z,/h are maximum concentration, lateral position, and location of maximum ~n~nt~t~on from vertical rake at that hrterai position R, in this case is zero The actual offset ... were drawn to fit the data as measured, but a generous allowance was made for scatter in order that they might also satisfy our physical intuition The graph suggests that the largest concentrations ... eo.hand y,/h are the value and lateral position of the maximum concentration For the elevation of the rake, see the adjacent column and note t t xa and z/h are centerline concentration and elevation...
- 34
- 213
- 0
Báo cáo y học: " Antecedents of hospital admission for deliberate self-harm from a 14-year follow-up study using data-linkage" ppsx
Ngày tải lên :
11/08/2014, 16:22
... health contacts, electoral roll and other related administrative data sets for WA [11] Information about individuals admitted to hospitals in other Australian states and territories is not available ... was the methodology Followup via data- linkage to administrative datasets conferred several advantages over a traditional longitudinal followup, such as: being far more cost effective than face-to-face ... for Areas (SEIFA) Based on Census information, these SEIFA provide a measure of area ‘disadvantage’ and can be used to assess socio-economic conditions by geographical areas [18] Classification...
- 11
- 387
- 0
Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf
Ngày tải lên :
11/08/2014, 17:20
... Milliken et al (2007) age; percentage for all other variables c UK data weighted to take account of sampling weights d Demographic data are not separately available for those on active duty and those ... US data are limited in several ways First, although the data relate to the same Iraq deployment, they were collected in different ways The PDHRA data was collected cross-sectionally in 20056 and ... the final response rate was 76% Analysis All statistical analyses were undertaken using the statistical software package STATA (version 10.0) [22] Weighted and unweighted (not shown) prevalence...
- 12
- 469
- 0
Báo cáo y học: "Hyperuricemia and the risk for subclinical coronary atherosclerosis - data from a prospective observational cohort study" potx
Ngày tải lên :
12/08/2014, 15:23
... raw data sets and takes responsibility for the integrity of the data and the accuracy of the data analysis Takeda Pharmaceuticals International, Inc did not have access to the raw data, and Takeda ... 114:1761-1791 Tanaka M, Tomiyasu K, Fukui M, Akamabe S, Kobayashi-Takenaka Y, Nakano K, Kadono M, Hasegawa G, Oda Y, Nakamura N: Evaluation of characteristics and degree of remodeling in coronary atherosclerotic ... antioxidant defense in humans against oxidant- and radical-caused aging and cancer: a hypothesis Proc Natl Acad Sci USA 1981, 78:6858-6862 Gagliardi AC, Miname MH, Santos RD: Uric acid: a marker...
- 8
- 350
- 0
Báo cáo y học: "Health related quality of life in trauma patients. Data from a one-year follow up study compared with the general population" potx
Ngày tải lên :
13/08/2014, 23:20
... the data, performing the data analyses and writing the article LS also collected data ISB, LS and HM participated in the planning of the study and discussions during data analyses, read the manuscript ... replaced according to the SF-36 manual [47] When an item was missing on the HADS and IES, missing data were replaced with the patients’ mean value for each subscale Data on categorical variables ... trauma patients who did not require intensive-care treatment • Identify predictors of health-related quality of life after trauma and hospital stay among demographic Page of 12 data, trauma characteristics,...
- 12
- 383
- 0