diffraction from a single square slit

... demonstrated major variants in C18L that were distinct from a single variant present in C18E; major variants in C98L that were distinct from a single major variant present in C98E; and major variants ... placed on a highly active antiretroviral therapy (HAART) regimen of abacavir, nevirapine and zidovidine in January 1999, which suppressed plasma and CSF viral loads to below detectable levels and ... Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Ogawa Y, Meguro K, Fujino M: A small-molecule, nonpeptide CCR5 antagonist with highly potent and...

Ngày tải lên: 18/06/2014, 18:20

... Boolean reduction The task is facilitated by treating one variable at a time Given any variable, xi , and keeping in mind that some observed state transitions arise from random perturbations rather ... estimation of the mean of a distribution identifies a single value as the candidate for the mean, and typically the probability of exactly estimating the mean is zero What this paper provides, and ... EURASIP Journal on Bioinformatics and Systems Biology goal is to infer a PBN that is a good candidate to have generated it This situation is analogous to that of designing a Wiener filter from a...

Ngày tải lên: 22/06/2014, 19:20

... esophageal carcinoma Interact Cardiovasc Thorac Surg 2008, 7:809-812 Shiono S, Kawamura M, Sato T, Nakagawa K, Nakajima J, Yoshino I, Ikeda N, Horio H, Akiyama H, Kobayashi K: Disease-free interval ... indicated that solitary pulmonary metastasis from esophageal carcinoma was a favorable indicator for surgical treatment [6] In this article, patients with solitary pulmonary metastasis also showed ... 57:425-433 13 Nakamura T, Hayashi K, Ota M, Eguchi R, Ide H, Takasaki K, Mitsuhashi N: Salvage esophagectomy after definitive chemotherapy and radiotherapy for advanced esophageal cancer Am J Surg...

Ngày tải lên: 10/08/2014, 09:22

... disorder; APA: American Psychiatric Association; AUDIT: Alcohol Use Disorder Identification Test; BRAIN: Bipolar Research and Innovation Network; DSM-IV: Diagnostic and Statistical Manual of Mental ... Meyer DA: A rating scale for mania: reliability, validity and sensitivity Br J Psychiatry 1978, 133:429-435 103 Favre S, Aubry JM, Gex-Fabry M, Ragama-Pardos E, McQuillan A, Bertschy G: [Translation ... [25 refs] 96 Maffei C, Fossati A, Agostoni I, Barraco A, Bagnato M, Deborah D, Namia C, Novella L, Petrachi M: Interrater reliability and internal consistency of the structured clinical interview...

Ngày tải lên: 11/08/2014, 16:23

... sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in ... the gamma gliadin protein families and sequence redundancy within the databases, peptide data were further inspected manually For each protein band, individual gamma gliadin peptides obtained from ... evidence from current EST data that the other seven gamma gliadin variants are expressed Identification of Butte 86 gamma gliadins by MS/MS Because neither the NCBI database nor any single EST assembly...

Ngày tải lên: 12/08/2014, 03:21

... Institutional Animal Care and Use Committee, and the NIH Viral RNA isolation and cDNA synthesis Viral RNA was isolated from each animal at defined time points following infection Cell-free plasma was ... injection Animal r00098 (r98) was infected by intrarectal inoculation with 10 MID50 SIVmac239 Viral RNA was isolated from frozen plasma samples from animal r00065 collected at days 4, 7, 11, and 18 ... approach was used for all amplifications The following primers designed to amplify a region of the viral Nef gene were used for the first round of PCR: 5'-CAAAGAAGGAGACGGTGGAG-3' and 5'-CATCAAGAAAGTGGGCGTTC-3'...

Ngày tải lên: 12/08/2014, 23:21

... Naidoo) Uganda: MRC/Uganda Virus Research Institute, Entebbe (H Grosskurth, A Kamali, P Kaleebu, J Mugisha, U Bahemuka, F Lyagoba, P Tabuga) Spain: Hospital Clinic-IDIBAPS Univ of Barcelona Barcelona ... g/ml streptavidin-conjugated alkaline phosphatase (ALP; Mabtech, Sweden) was added The plate was incubated at room temperature for 40 The streptavidinALP was then discarded and the plate washed seven ... Trial Physician Sarah Fidler Trial Statistician Abdel Babiker Data and Safety Monitoring Committee A McLaren (in memoriam), V Beral, G Chene, J Hakim Central Virology Laboratories and Repositories...

Ngày tải lên: 13/08/2014, 01:21

... my stay enjoyable To all my family members, especially my parents, that are always there and have always cared for me No words can express my gratitude to all of you At last, many thanks to all ... To trap a single atom, we start with an atomic cloud in a magneto-optical trap (MOT) and use an optical dipole trap to trap a single atom at the focus of the lens1 A MOT consists of three pairs ... is fairly complicated that involves the filtering of the optical sideband from an electro-optic phase modulator Another method to excite the atom is through adiabatic rapid passage (ARP) via chirped...

Ngày tải lên: 30/09/2015, 10:11

... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...

Ngày tải lên: 14/12/2013, 18:16

... obtained from the Japan Snake Institute, Gunma, Japan Phenyl Sepharose CL-4B, DEAE Sepharose CL-6B and Superdex 75 were purchased from Amersham Pharmacia Biotech; Concanavalin A (Con A) agarose ... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and ... analysis of the DNase I family The mammalian group formed a relatively tight cluster, while the snake (E quadrivirgata, E climacophora and A blomhoffii), amphibian (X laevis, Rana catesbeiana,...

Ngày tải lên: 20/02/2014, 23:20

... conformational changes in this motif The Ca2+ signal change and the accompanying conformational change in the canonical EF-hand are probably relayed to the SAM domain via the paired ‘hidden’ EF-hand, resulting ... via a short antiparallel b-sheet Ca2+ is coordinated by the mainchain carbonyl and side-chain carboxyl oxygens at the 12- or 14-residue loop One pair of EF-hands usually forms a globular domain ... reveals STIM1 surface exposure Proc Natl Acad Sci USA 104, 3693–3697 Zhang SL, Yu Y, Roos J, Kozak JA, Deerinck TJ, Ellisman MH, Stauderman KA & Cahalan MD (2005) STIM1 is a Ca2+ sensor that activates...

Ngày tải lên: 07/03/2014, 00:20

... (5¢-ATG AAAGTTCAAGAGAAGATCAATCTC-3¢); ELM99 (5¢ATGAGGGGTGCTATGAAGATCAAGG-3¢); ATL100 (5¢-ATTAGGGGTGCGCTGAAGATCAAGG-3¢); ATL14L15F18 (5¢-AAATCCGATGCAATCCTGGACCTGCTG AAGGAATTTCTTTCCACCGACGCC-3¢) For ... palmitic acid to the sample The values are mean ± SD from at least four different analyses Plant Type Ergosterol Palmitic Acid E lagascae E lagascae E lagascae E lagascae A thaliana A thaliana ... was amplified from E lagascae cDNA by the use of primers SCPElNE (5¢-ACTGGAATTCAACT CAAGTCCCAAAATATTTTGGAT-3¢) and SCPElCN (5¢-TCATGGCGGCCGCTCACAGCTTCGACGGCTTGG GGAA-3¢) The PCR fragment obtained...

Ngày tải lên: 16/03/2014, 12:20

... membrane potentials measured in discontinuous voltage-clamp mode A and C show that depolarizations activate no measurable inward current after steady-state blockade by TTX B and D show that Na+ ... El Ayeb, M., Rochat, H., Allen, P.D., Pessah, I.N., De Waard, M & Sabatier, J.M (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine ... structural folds Some of these affect even intracellular channels such as the ryanodine-sensitive calcium channel activators maurocalcine [3] and imperatoxin A [20] This indicates that small changes...

Ngày tải lên: 31/03/2014, 08:20

... Coso D, Bardou VJ, Stoppa AM, Braud AC, Bouabdallah R, Sainty D, Mozziconacci MJ, Lafage M, Damaj G, Blaise D, Gastaut JA, Maraninchi D: The benefit of induction chemotherapy in patients age > or ... years Cancer 2004, 101:325-331 Alymara V, Tzouvara E, Vartholomatos G, Chaidos A, Tsiara S, Bourantas KL: A single- center, retrospective study of management Page of (page number not for citation ... CR as the following: HA regimen as described above, DA (DNR, 30 mg/m2 daily for days, Ara-C 100 mg/m2 daily for days) or IDA (idarubicin, mg/m2 daily for days, Ara-C 100 mg/m2 daily for days),...

Ngày tải lên: 10/08/2014, 22:20

... Merla E, Capparella V, Callea V, Cangialosi C, Grasso M, Rossini F, Galli M, Catalano L, Zamagni E, Petrucci MT, De stefano V, Ceccarelli M, Ambrosini MT, Avonto I, Falco P, Ciccone G, Liberati AM, ... Grzegorz SN, Morie AG, Angela D, Martha QL, Suzanne H, Rafael F, John AL, Robert AK, Philip RG, Thomas EW: Combination therapy with thalidomide and dexamethasone in patients with newly diagnosed multiple ... multiple myeloma not undergoing upfront autologous stem cell transplantation: a phase II trial, haematologica 2005, 90:1650-54 Rajkumar SV, Hayman S, Gertz MA, Dispenzieri A, Lacy MQ, Greipp...

Ngày tải lên: 10/08/2014, 22:20

... Metastasis of carcinoma of the uterine cervix to the nasal dorsum J Craniofac Surg 2009, 20(3):971-973 Baykal C, Baykal Y, Taskiran C, Esinler I, Demirol A, Doğan R, Ayhan A: An extraordinary case ... of four malignancies in the same patient including a cervical carcinoma and a basal cell carcinoma but in a metachronous setting [6] Human papilloma virus (HPV) infection has a wellestablished ... journal Page of doi:10.1186/1752-1947-5-462 Cite this article as: Mesmoudi et al.: Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a...

Ngày tải lên: 10/08/2014, 23:20

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT...

Ngày tải lên: 12/08/2014, 03:20

... body Animals were restrained, and the area was scraped with a sharp spoon until blood was visible The material obtained from the scraped area was transferred into a Vacutainer® glass tube labelled ... elimination attempt (Reddin 1997) Avermectins, as well as other acaricides, are not effective against mite eggs (Alva-Vades et al 1984) In order to achieve elimination of mange from a naturally ... emphasizes that thorough precautions and preparations should always be an integral part of a mange elimination program Under-dosing or missing one single animal could lead to failure, if the goal...

Ngày tải lên: 12/08/2014, 15:20

... its design, co-ordination and evaluation of data, and helped in drafting the manuscript All authors read and approved the final manuscript Additional material Additional File DNA fingerprinting ... among hospitalised TB patients [12] Demographic data, including sex, age as well as date of diagnosis, clinical diagnosis, and treatment history, were obtained by review of medical and laboratory ... Scientifique (CNRS, France) 16 17 18 19 Das S, Narayanan S, Hari L, Mohan NS, Somasundaram S, Selvakumar N, Narayanan P: Simultaneous infection with multiple strains of Mycobacterium tuberculosis...

Ngày tải lên: 12/08/2014, 16:20