622 one three state driver inferred from a single block 655

... Alaska Arizona Arkansas California Colorado Connecticut Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi ... broad banding is mentioned by many states, only a few states have adopted a statewide system Performance Evaluation and Reward Systems Performance appraisal systems have often been criticized as ... evaluate state government management performance The GPP’s objective is to evaluate management performance across five areas: financial management, capital management, information technology, human...

Ngày tải lên: 12/06/2014, 19:31

... DNA (e.g by suitable endonucleases) yields elutable chromatin fragments preferably originating from regions far from matrix attachment points As DNA replication foci are probably located near ... for 30 at 37 °C Cell culture, transient hypoxia, reoxygenation and radioactive labeling Cell fractionation T24 cells (gift from Altana Pharma, Konstanz, Germany) were grown in plastic flasks in ... and chromatin-bound proteins were prepared after the indicated incubation conditions (for details see Materials and methods) and equal amounts were separated on an 8% SDS/polyacrylamide gel After...

Ngày tải lên: 21/02/2014, 00:20

... demonstrated major variants in C18L that were distinct from a single variant present in C18E; major variants in C98L that were distinct from a single major variant present in C98E; and major variants ... placed on a highly active antiretroviral therapy (HAART) regimen of abacavir, nevirapine and zidovidine in January 1999, which suppressed plasma and CSF viral loads to below detectable levels and ... Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Ogawa Y, Meguro K, Fujino M: A small-molecule, nonpeptide CCR5 antagonist with highly potent and...

Ngày tải lên: 18/06/2014, 18:20

... Boolean reduction The task is facilitated by treating one variable at a time Given any variable, xi , and keeping in mind that some observed state transitions arise from random perturbations rather ... temporal data sequence results from a BN without perturbations, then a given state will always be followed by a unique state at the next time point, and each row of matrix C contains at most one ... an attractor cycle (or simply, attractor), and will continue to cycle thereafter Nonattractor states are transient and are visited at most once on any network trajectory The level of a state...

Ngày tải lên: 22/06/2014, 19:20

... esophageal carcinoma Interact Cardiovasc Thorac Surg 2008, 7:809-812 Shiono S, Kawamura M, Sato T, Nakagawa K, Nakajima J, Yoshino I, Ikeda N, Horio H, Akiyama H, Kobayashi K: Disease-free interval ... 57:425-433 13 Nakamura T, Hayashi K, Ota M, Eguchi R, Ide H, Takasaki K, Mitsuhashi N: Salvage esophagectomy after definitive chemotherapy and radiotherapy for advanced esophageal cancer Am J Surg ... to elucidate its efficacy A previous report indicated that solitary pulmonary metastasis from esophageal carcinoma was a favorable indicator for surgical treatment [6] In this article, patients...

Ngày tải lên: 10/08/2014, 09:22

... disorder; APA: American Psychiatric Association; AUDIT: Alcohol Use Disorder Identification Test; BRAIN: Bipolar Research and Innovation Network; DSM-IV: Diagnostic and Statistical Manual of Mental ... Meyer DA: A rating scale for mania: reliability, validity and sensitivity Br J Psychiatry 1978, 133:429-435 103 Favre S, Aubry JM, Gex-Fabry M, Ragama-Pardos E, McQuillan A, Bertschy G: [Translation ... http://www.biomedcentral.com/1471-244X/11/25 inhabitants This region consists of a large rural area, one town with 18,600 inhabitants, and some villages The distance from one end of the area to the other is about...

Ngày tải lên: 11/08/2014, 16:23

... sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in ... evidence from current EST data that the other seven gamma gliadin variants are expressed Identification of Butte 86 gamma gliadins by MS/MS Because neither the NCBI database nor any single EST assembly ... the gamma gliadin protein families and sequence redundancy within the databases, peptide data were further inspected manually For each protein band, individual gamma gliadin peptides obtained from...

Ngày tải lên: 12/08/2014, 03:21

... Institutional Animal Care and Use Committee, and the NIH Viral RNA isolation and cDNA synthesis Viral RNA was isolated from each animal at defined time points following infection Cell-free plasma was ... injection Animal r00098 (r98) was infected by intrarectal inoculation with 10 MID50 SIVmac239 Viral RNA was isolated from frozen plasma samples from animal r00065 collected at days 4, 7, 11, and 18 ... approach was used for all amplifications The following primers designed to amplify a region of the viral Nef gene were used for the first round of PCR: 5'-CAAAGAAGGAGACGGTGGAG-3' and 5'-CATCAAGAAAGTGGGCGTTC-3'...

Ngày tải lên: 12/08/2014, 23:21

... Naidoo) Uganda: MRC/Uganda Virus Research Institute, Entebbe (H Grosskurth, A Kamali, P Kaleebu, J Mugisha, U Bahemuka, F Lyagoba, P Tabuga) Spain: Hospital Clinic-IDIBAPS Univ of Barcelona Barcelona ... g/ml streptavidin-conjugated alkaline phosphatase (ALP; Mabtech, Sweden) was added The plate was incubated at room temperature for 40 The streptavidinALP was then discarded and the plate washed seven ... Trial Physician Sarah Fidler Trial Statistician Abdel Babiker Data and Safety Monitoring Committee A McLaren (in memoriam), V Beral, G Chene, J Hakim Central Virology Laboratories and Repositories...

Ngày tải lên: 13/08/2014, 01:21

... To trap a single atom, we start with an atomic cloud in a magneto-optical trap (MOT) and use an optical dipole trap to trap a single atom at the focus of the lens1 A MOT consists of three pairs ... Thank you for making my stay enjoyable To all my family members, especially my parents, that are always there and have always cared for me No words can express my gratitude to all of you At last, ... made use of the ⇤-type energy level scheme that consists of one excited state and two metastable ground states (�g1 � and �g2 �) The pump laser and the cavity drive a vacuum-stimulated Raman adiabatic...

Ngày tải lên: 30/09/2015, 10:11

... believe that they win customer loyalty by offering a loyalty award program A loyalty program may be a good feature as part of a customer relationship management program, but many loyalty schemes ... now have and more anagement Management is the task of making trade-offs and juggling contradictions Harvard’s Rosabeth Moss Kanter observed: “The ultimate corporate balancing act: Cut back and ... Are the goals reasonable and reachable in the light of the situational analysis? • Does the strategy seem adequate to deliver the stated goals? 114 Marketing Insights from A to Z • Are the tactics...

Ngày tải lên: 24/10/2013, 08:20

... 203–206 Kato K, Fujiyama K, Hatanaka HS, Prijambada ID, Negoro S, Urabe I & Okada H (1991) Amino acid alterations essential for increasing the catalytic activity of the nylon-oligomer degradation ... Shibata N, Takeo M, Negoro S & Higuchi Y (2005) Crystallization and x-ray diffraction analysis of 6-aminohexanoate-dimer hydrolase from Arthrobacter sp KI72 Acta Crystallogr F61, 928–930 Hatanaka ... Achromobacter guttatus KI72 Eur J Biochem 80, 489–495 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masuda S, Matsunaga N & Okada H (1981) Purification and characterization of 6-aminohexanoic acid...

Ngày tải lên: 07/03/2014, 00:20

... GCAAAGAAGGTCAATTGCTCC TACGACAGCCAATGCCAGGAT GGAAAGGAACAGTGGGTTAGT ATCAGCCGCCAAAGTGCCAGG GGGAAGGAACGGTGGATTGAG CTGCATTCAGAGGGCTAATGG GGAACTCAACGGTGGATTAGT CTCTACCACCAAGTGTTGGCT TTCCTACCTTCAAAGCATGGG ... proteins from a wider variety of fish species Materials and methods Materials The females of the Japanese eel, A japonica, sexually matured by hormonal injection, were supplied from Hamanako Branch, ... TTCCTACCTTCAAAGCATGGG GTGCTCAACTCAGGCATGTCA CTCATTCTCTCCAGAAGCTGG GCTCCTAGACTCTGACACCAG FEBS Journal 277 (2010) 4674–4684 ª 2010 The Authors Journal compilation ª 2010 FEBS K Sano et al Egg envelope of Japanese eel...

Ngày tải lên: 15/03/2014, 23:20

... unilateral apical infiltrates, haemoptysis and cavities, and unilateral apical infiltrates and fever This model provided significant better fit to the data than model Model is a three- latent class ... Table compares estimates for Se, Spe and prevalence obtained by bivariate analysis with culture and composite reference standard and by the LCA approach Most values are similar, only the prevalence ... estimated Se and Spe of disease characteristics with an LCA strategy [17,27,28] In patients for whom results from at least diagnostic TB tests are available, LCA can distinguish two subgroups: “patients...

Ngày tải lên: 22/03/2014, 18:20

... empirical analysis using a large German panel data set Fred Ramb 26 22 2007 Volatile multinationals? Evidence from the labor demand of German firms Claudia M Buch Alexander Lipponer 23 2007 International ... (2008) talks with practitioners of the savings banks and cooperative banks sector, we know 11 From that the average duration for savings accounts is assumed to be approximately three years There are, ... quality of banking and regional growth Hasan, Koetter, Wedow 11 2007 Welfare effects of financial integration Fecht, Grüner, Hartmann 12 2007 The marketability of bank assets and managerial Falko...

Ngày tải lên: 22/03/2014, 23:20

... In one study, the non-mammalian origin of affibody proteins was shown to be an advantage for diagnostic applications involving sandwich assays Exchanging one of the reagents in a classical two-antibody ... systems are also being investigated, including b-lactamase-based protein fragment complementation assay [15], staphylococcal display [16,17], microbead display [18] and ribosomal display (S Grimm and ... facilitate directional head-to-tail polymerization at the gene fragment level and to increase the chemical stability of the protein towards hydroxylamine (via a Gly to Ala substitution simultaneously...

Ngày tải lên: 23/03/2014, 07:20

... H., Kanamaru, K., Fujiwara, M., Tanaka, K., Takahashi, H., Unno, K., Sato, S., Tabata, S., Hayashi, H., Miyake, C., Yokota, A & Shibata, D (2000) Chloroplast development in Arabidopsis thaliana ... putative plastid RNA polymerase o factors in Arabidopsis thaliana FEBS Lett 481, 47–52 37 Tanaka, K., Tozawa, Y., Mochizuki, N., Shinozaki, K., Nagatani, A. , Wakasa, K & Takahashi, H (1997) Characterization ... Molecular characterization of a positively photoregulated nuclear gene for a chloroplast RNA polymerase r factor in Cyanidium caldarium Proc Natl Acad Sci USA 93, 3313–3318 10 Tanaka, K., Oikawa,...

Ngày tải lên: 31/03/2014, 07:20

... Amsterdam is a tertiary PICU with 14 beds admitting patients from the greater Amsterdam area Medical, surgical and trauma patients and patients from all pediatric subspecialties are admitted In this ... Alamgir AH, Anis AH, Fitzgerald MJ, Marra CA: Evaluating health-related quality-of-life studies in paediatric populations: some conceptual, methodological and developmental considerations and ... items from the original social scale were removed and the autonomy scale was removed in its totality [31] Patient characteristics were obtained from medical records and the Patient Data Management...

Ngày tải lên: 18/06/2014, 22:20

... subject left the measurement area and markers were removed After a 5–10 minutes break the markers were replaced and subject was tested a second time Data analysis and raw data handling After the recording ... excursions for reaching phase from rawdata in Matlab software Statistical analysis Statistical analyses were performed with SPSS (Statistical Packages for Social Sciences, 11.0) Descriptive statistics ... clinical studies, we divided the shoulder elevation into abduction and flexion and recalculated the values for elbow angle into an anatomical angle rather the technical/mathematical angle values One...

Ngày tải lên: 19/06/2014, 10:20