Alloreactive t cells and cytokines in murine graft versus host disease 1
... competent cells in the graft, the host appearing “foreign” to the graft, and the inability of the host to react sufficiently against the graft The interaction of donor cells and host target tissues ... effector T cells MIP -1 and IP -10 better attracted Th1 cells than Th2 cells, whereas MDC, TARC, I-309, and eotaxin demonstrated higher chemotactic activity for T...
Ngày tải lên: 16/09/2015, 17:13
... Diphtheria toxin receptor-binding domain substitution with interleukin 6: Genetic construction and interleukin receptorspecific action of a diphtheria toxin-related interleukin fusion protein ... Limiting dilution analysis for alloreactive, TCGFsecretory T cells: two related LDA methods that discriminate between unstimulated precursor T cells and in vivo-alloactivated T cells...
Ngày tải lên: 16/09/2015, 17:13
... may contribute to the preferential recruitment of inflammatory cells into the liver and skin, but not into the heart, in acute GVHD The predominantly expressed chemokines MIP1α and Mig in the spleen, ... CD8+ T cells These observations indicate that other chemokines other than MIP-1α play a critical role in the recruitment of CD4+ T cells into the target organs It was rece...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 3
... distinct chemokine expression pattern in the target organs that may contribute to the preferential recruitment of inflammatory cells into the liver and skin, but not into the heart, in acute GVHD ... pathway In the recipients, T cells were activated and proliferated in the lymphoid system, and the effector T cells then migrated into the liver, skin and intestines whi...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 2
... ATCCATCTGGCTAGGTCAGG–3’ Forward 5’- CAACGCTATCGCGTCGGATC–3’ Reverse 5’- TCGCTACTTAGCTACTCGAT–3’ Forward 5’- GCTAGGTCATCGGTCATCGG–3’ Reverse 5’- ACCAATGTCGATTAGCTACC–3’ Forward 5’- TTAAATCGTTGCGACAACTA–3’ ... AACCTTTAGTACCCATGCCA–3’ Reverse 5’- CACCTGTAGCTAGCTGCTAG–3’ Forward 5’- TAGCTGTCAACTCGATCTCC–3’ Reverse 5’- GGTCCTATTACGGCTACTAC–3’ Forward 5’-GTGGGCCGCTCTAGGCAC-3’ Reverse 5’-CTTTGATGTCA...
Ngày tải lên: 16/09/2015, 17:13
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt
... TGGCTGTTTCTGGCTGTTACTG and AATCAGCAGCGACTCCTTTTCC; IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC; β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGATGTCACGCACGATTTCC Statistical analysis ... Morishita R, Sugimoto T, Aoki M, Kida I, Tomita N, Moriguchi A, Maeda K, Sawa Y, Kaneda Y, Higaki J, et al.: In vivo transfection of cis element "decoy" against nuclear factor...
Ngày tải lên: 09/08/2014, 08:22
Tài liệu Review of Chronic Graft- Versus-Host Disease in Children After Allogeneic Stem Cell Transplantation: Nursing Perspective pptx
... T and B cells regimen-related toxicity in children undergoing allogeneic in hematopoietic stemchronic graft -versus-host disease with and transplants induce cell transplantation Biology of Blood ... Factors for Chronic Graft -Versus-Host Disease in Children Postallogeneic Hematopoietic Stem Cell Transplantation Authors Sample Research Approach Main Findings Carlens...
Ngày tải lên: 12/02/2014, 19:20
Báo cáo y học: " T cells and post menopausal osteoporosis in murine models" doc
... thymic T cell output that contributes to the restoration of a wide T cell repertoire [29], although the intensity of thymic rebound declines with age Restoration of thymic function after castration ... targets will emerge Competing interests The author declares that they have no competing interests References T cells differentiate in the thymus, an organ that undergoes progressive s...
Ngày tải lên: 09/08/2014, 10:20
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot
... administration, the ability to migrate to sites of T cell activation and generation of CTLs Activated and mature DCs results in antigen-specific immunity, while fully immature and inactivated ... class I hTERT pulsed DCs Vaccinations with DCT and DCTI in 10 patients Both vaccines (DCT and DCTI) were equivalent in eliciting CD8 +T cell responses and there were...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo sinh học: " Complement component C5a Promotes Expression of IL-22 and IL-17 from Human T cells and its Implication in Age-related Macular Degeneratio" potx
... from human T cells in vitro To study the role of C5a on human CD4 + T cells, we used ELISA and intracellular staining to detect cytokine expression PBMCs from AMD patients and controls were treated ... Intracytoplasmic staining of IL-22 and IL-17 from both controls and AMD patients after days of culture with or without C5a and C5aR antagonist Liu...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo y học: "Decreased effector memory CD45RA+CD62L– CD8+ T cells and increased central memory CD45RA–CD62L+ CD8+ T cells in peripheral blood of rheumatoid arthritis patients" ppt
... effector memory CD8+ T cells in RA may indicate an increase in the migration of these cells into sites of inflammation, and therefore may contribute to ongoing synovial inflammation Competing interests ... suggested that the differentiation may not be linear at all The central and effector memory phenotypes of CD4+ and CD8+ T cells in peripheral bl...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt
... status, or the relative proportions of the majority of cellular populations within the lymphocyte gate in lupus patients and control individuals However, the proportion of plasma cells within ... test) The proportion of NKT cells is a heritable trait To determine whether the proportion of NKT cells is genetically determined, we examined the correlation...
Ngày tải lên: 09/08/2014, 13:21
báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx
... effect of IDO both in promoting apoptosis and increasing Tregs It demonstrated that 1-MT could efficiently reversed enhancement of T cells apoptosis and increased Tregs proportion in vitro It implied ... 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The PCR products were inserted into the pMD19 -T Simple Vector (Takara) usi...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: " Human herpesvirus 6 major immediate early promoter has strong activity in T cells and is useful for heterologous gene expression" ppsx
... 6MIEpF-381 5’-agt cgg tac cac att cct gtt tca tga tgt gta gc-3’ 6MIEpF-214 5’-agt cgg tac ctc ctg ttt ttg agt aag ata tga c-3’ 6MIEpF- 165 5’-agt cgg tac cag cta att tcc att cca tat ttg tc-3’ 6MIEpF-102 ... OCT-1-binding site (Figure 3) The transcriptional regulators that bind to these sites might enhance the promoter activity of HHV -6 MIEp Interestingly, the promoter construct that c...
Ngày tải lên: 11/08/2014, 21:21