... GITR-ligand interactions, abrogating the suppressive effect of Treg cells [37] With this in mind, it could be interesting to investigate whether the accumulated Treg cells in patients with arthritis ... one hand, transfer of Treg cells 24 hours after intra-articular antigen challenge might be too late to inhibit activation of effector T cells and their migration to the joint Indeed, T- cell activation ... CD25-expressing cells or transfer of CD4+CD25+ cells, in the present study we demonstrated that Treg cells modulate the onset of AIA but are ineffective at later stages, calling into question their...
Ngày tải lên: 09/08/2014, 06:22
... might not be a feasible option treatment decreases the infiltrate in joints Furthermore, RA patients relapse shortly after withdrawal of anti-TNF-α [19] and thus, despite the dampening of joint inflammation ... that Treg isolated from patients with active RA before treatment with anti-TNF-α were unable to suppress proinflammatory cytokine secretion from activated T cells and monocytes After anti-TNF-α treatment ... inflammation and the reinstatement of fully functional CD4+CD25+ Treg, RA is still not cured These strands of evidence seem to play down a hypothetical therapeutic role of CD4+CD25+ Treg in RA Are there...
Ngày tải lên: 09/08/2014, 06:23
The role of CD8 t cells in the differentiation of TNF iNOS producing dendritic cells and TH1 responses
... Abstract In this study, we showed that activated human CD8 T- cells could induce DCs to produce IL-12p70 in vitro and this interaction also resulted in the production of a cytokine milieu that ... each individual lymphocyte B cells and T cells are the major types of lymphocytes T cells provide important cell mediated immunity by participating in the cytolysis of infected cells through the ... unprecedented ability to activate naive T cells (Steinman and Cohn, 1974) These cells are now known as the primary instigators of the adaptive immunity as they are vital for detecting, alerting and...
Ngày tải lên: 09/09/2015, 18:58
báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx
... 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The PCR products were inserted into the pMD19 -T Simple Vector (Takara) using TA-cloning procedures, and ... effect of IDO both in promoting apoptosis and increasing Tregs It demonstrated that 1-MT could efficiently reversed enhancement of T cells apoptosis and increased Tregs proportion in vitro It implied ... sequencing analysis was used to identify the product of interest (pMD19IDO) Materials and methods To investigate IDO gene integration into CHO cells, total RNA was isolated from CHO cells transfected...
Ngày tải lên: 10/08/2014, 10:21
Tài liệu Báo cáo khoa học: Fatty acid synthesis Role of active site histidines and lysine in Cys-His-His-type b-ketoacyl-acyl carrier protein synthases ppt
... construct seven additional mutants using the following primers plus their complements: H298E, CGATTACCTGAACTCCGAGGGTACTTCGA CTCCG H298Q, CGATTACCTGAACTCCCAGGGTACTTCGAG TCCG K328H, (5¢-GGCGATTTCTGCAACCCACGCCATGAC ... 68% of that characterizing the wild-type, transfer continues until all the myristate is bound to K328A, revealing that, in this mutant, ACP does not inhibit transfer To probe the basis for the ... wild-type), this was only 58% and 35% of their activity at 22 °C At best, a trace of activity (< 0.1% of that of the wild-type) was detected for the other four mutants For all six mutants, adding...
Ngày tải lên: 19/02/2014, 08:20
Role of C-Reactive Protein and Procalcitonin in Differentiation of Tuberculosis from Bacterial Community Acquired Pneumonia potx
... antibiotic treatment of CAP and acute exacerbations of chronic obstructive pulmonary disease [19,20] based on the ability of PCT to discriminate between patients with or without bacterial infection ... showed the superiority of PCT for predicting the severity of bacterial CAP compared to CRP This is consistent with the finding that PCT is a good predictor of the severity of pneumonia and sepsis, ... this study suggest that CRP and PCT can help to discriminate between pulmonary TB and other common bacterial CAP in a setting of intermediate TB prevalence Significantly lower CRP and PCT serum...
Ngày tải lên: 22/03/2014, 18:20
Báo cáo y học: " (R)-albuterol decreases immune responses: role of activated T cells" docx
... TTCCATCCAGTTGCCTTCTTG (FW), GAAGGCCGTGGTTGTCACC (RE) (NM008355), IL-13: AATCTGTCTGCAGGTGGGCT (FW), GGCTTCTCACTTTCATTGGCAC (RE) (NM031168), IFNγ: AGGTGTCACAACTGCTGCCA (FW), ACACCCGAATGAGCTGCTCT (RE) ... well as inhibition of cytokine-induced release of eotaxin, a potent eosinophil chemoattractant [36] Beta agonists also inhibit the secretion of granular proteins [37] and the production of superoxide ... 1200 Short acting beta agonists, including albuterol, are a mainstay of asthma therapy due to their ability to promote bronchodilation; in addition they may display antiinflammatory properties [10,11,30,31]...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo khoa học: "The role of body mass index and diabetes in the development of acute organ failure and subsequent mortality in an observational cohor" doc
... surrogate for critical illness, in that these events occurred in the setting of a hospitalization Our results not support the contention that obesity itself is a risk factor for increased mortality ... failure in this cohort 10 11 12 13 14 15 Competing interests The authors declare that they have no competing interests 16 Authors' contributions 17 KS and RSM designed the study, interpreted the data ... care costs currently being expended in this growing population of patients Acknowledgements The authors thank the staff and participants in the ARIC study for their important contributions The ARIC...
Ngày tải lên: 13/08/2014, 03:20
Báo cáo y học: " Age of red blood cells and mortality in the critically ill" ppsx
... simple models to localized subsets of the data to build up a function that describes the deterministic part of the variation in the data, point by point Statistical analysis Statistical analysis ... performed mostly outside the critical care setting with a lower expected mortality rate and, thus, a lesser ability to detect relative reduction in risk Therefore, because of the limitations of the previous ... using an optical reader After checking the data and repeated queries to the study sites, the missing data related to RBC transfusions constituted
Ngày tải lên: 14/08/2014, 08:21
The role of adenosine, adenosine receptors and transporters in the modulation of cell death
... Chemical structure of adenosine Introduction 1.1.1.2 Physiological Roles of Adenosine The findings that adenosine can stimulate cAMP formation in brain cells (Sattin & Rall 1970) was the start of a ... adenosine-mediated stimulation of adenylate cyclase in rat brain was effected via distinct high affinity binding sites (localized in striatal membranes) and low affinity binding sites (present throughout the ... receptors modulate secretion of neurotransmitters in the brain and in the periphery and may mediate effects of lamin-related secretory protein netrin-1 on axon outgrowth (Corset et al 2000) The...
Ngày tải lên: 11/09/2015, 16:07
The role of small GTPases rap1 and rhoa in growth hormone signal transduction
... phosphotyrosine-binding domain containing proteins and initiate several signaling pathways to regulate gene transcription, metabolic enzymes and actin cytoskeleton, ultimately leading to GH stimulation of ... Stat5 (Goh et al., 2000) Interestingly, c-Cbl, a CrkII interacting protein, also increases PI-3 kinase activity and inhibits GH stimulated Stat5 mediated transcription through ubiquitilation and ... coordinate the pleiotropic effects of GH 1.4.6 Stat pathway Stats are a family of important transcription factors, utilized by many cytokines, including GH, prolactin, erythropoietin, interleukins and...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 5
... Diphtheria toxin receptor-binding domain substitution with interleukin 6: Genetic construction and interleukin receptorspecific action of a diphtheria toxin-related interleukin fusion protein ... transplantation Tissue Antigens 59: 241-250 Ringheim GE, Freimark BD and Robb RJ 1991 Quantitative characterization of the intrinsic ligand-binding affinity of the interleukin receptor beta chain and ... 1987 Diphtheria toxin receptor binding domain substitution with interleukin2: genetic construction and properties of a diphtheria toxin-related interleukin-2 fusion protein Protein Eng.1: 493 Williamson...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 4
... damages to these organs Our study found that the distinctive pattern of chemokines expressed in target/nontarget organs correlate with the infiltration kinetics of the donor T cells into these ... conditions resulting in complete neutralization of its native counterpart, suggesting the feasibility of employing this truncated form of IT in the treatment of human diseases The DT390 moiety ... may contribute to the preferential recruitment of inflammatory cells into the liver and skin, but not into the heart, in acute GVHD The predominantly expressed chemokines MIP1α and Mig in the spleen,...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 3
... Activated alloreactive T cells would infiltrate into target organs of acute GVHD We then examined the infiltration of T cells into the liver, a major target organ of acute GVHD, in SCID mice that ... Results population on day post injection showed the proliferation of the injected cells in the control group but not the second batch of cells injected into the experimental group, indicating that ... day tt day 14 l t ti days post-transplantation Fig.14 Infiltration of donor T cells into the liver of the secondary recipient SCID mice Recipient mice were killed at the indicated time point, and...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 2
... 5’- TAGCTTCTGATCGATGCATG–3’ Reverse 5’- TCTCATGCTAATCGATCGAT–3’ Forward 5’- TACTGCTACTGATCGACTGC–3’ Reverse 5’- ATCCATCTGGCTAGGTCAGG–3’ Forward 5’- CAACGCTATCGCGTCGGATC–3’ Reverse 5’- TCGCTACTTAGCTACTCGAT–3’ ... GCTGGAGAGCTACAAGAGGATCA 3’ Reverse primer: 5’ TCTCTCTTGAGCTTGGTGACAAAA 3’ 5’ CTACAGCTTCTTTGGGACACCTGCTGCT 3’ Forward primer: 5’ AGTGATAAGGAATGCACGATGCT 3’ Reverse primer: 5’ TGAGGTCTTTGAGGGATTTGTAGTG 3’ Probe: ... GGTCTACATCGATCGCTACT–3’ Forward 5’- ATAGACTCTCCGATATAGCT–3’ Reverse 5’- TAGCTATCGATCGATCGTAA–3’ Forward 5’- AACCTTTAGTACCCATGCCA–3’ Reverse 5’- CACCTGTAGCTAGCTGCTAG–3’ Forward 5’- TAGCTGTCAACTCGATCTCC–3’...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 1
... competent cells in the graft, the host appearing “foreign” to the graft, and the inability of the host to react sufficiently against the graft The interaction of donor cells and host target tissues ... due to the presence of the receptor binding domain of the toxin To overcome this limitation, genetically modified toxins were used in the construction where the cell binding domains of the toxins ... Diphtheria toxin 1.5.4.1 Native toxin Diphtheria toxin (DT) was the first investigated toxin DT is a 58,348 kDa protein consisting of 535 amino acids (Smith et al., 1980), containing cysteine...
Ngày tải lên: 16/09/2015, 17:13
Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps
... T cells of this subpopulation Overall, this study contributes to our understanding of recruitment of T cells to the joint in inflammatory arthritis and suggests that in the microenvironment of ... protein (Figure 6) In addition, staining was demonstrated at the synovial lining and on many infiltrating inflammatory cells Protein levels of inflammatory chemokines in synovial fluid Protein ... differentiation pathway, and whether these differ between antiviral cytotoxic T lymphocytes (CTL) and cells in chronic inflammatory situations, remains unclear The population of CCL5+ T cells within the JIA...
Ngày tải lên: 09/08/2014, 07:20
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... factors in the supernatant inhibit the maturation of fusion cells and have a negative impact in the stimulation of T cells To determine the induction of WT1-specitic CD8+ T cells, a pentameric ... vaccine is still not clear in this experimental setting A recent study has demonstrated that vaccination with DCs/tumor fusion cells producing TGF-β resulted in the induction of Treg in vivo and ... supernatants in the generation of Treg in vitro is demonstrated in the present study, little is known about the impact of fusion cell vaccination on generating Treg The negative impact of fusion...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot
... stimulating T cell responses, stability of the phenotype following in vivo administration, the ability to migrate to sites of T cell activation and generation of CTLs Activated and mature DCs results ... demonstrated intravenous denileukin diftitox inducing disease regression (partial and complete in 20–30% of patients) This is due to inhibition of protein synthesis in cells expressing high and intermediate ... hTERT p540 is not expressed or is cryptic on the surface of tumour cells and that immunization of cancer patients with hTERT p540 leads to the production of T cells that not recognize tumour cells...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo sinh học: " Complement component C5a Promotes Expression of IL-22 and IL-17 from Human T cells and its Implication in Age-related Macular Degeneratio" potx
... production through two mechanisms: 1) promoting the direct interaction between monocytes and T cells; 2) indirectly stimulating the production of IL-1b and IL-6 from monocytes C5a can bind to the trans-membrane ... patients C5a may be one of the many factors related to this observed effect Other unknown factors may also contribute to this T cell activation seen in AMD patients Interestingly, the findings ... systemic activation may ultimately be manifest in the eye remain to be defined To date there is no effective treatments other than attempts to slow the progression of geographic atrophy form of...
Ngày tải lên: 18/06/2014, 22:20