... production of T cells that not recognize tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy to generate tetramer+ CD8 +T cells ... putative TAAgs A few studies have concluded that hTERT p540 is not expressed or is cryptic on the surface of tumour cells and that immunization of cancer patients with hTERT p540 leads to the ... of hTERT (p766 and p672) used in the study were promiscuous Ex Vivo Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that...
Ngày tải lên: 18/06/2014, 15:20
... with allergic asthma These findings suggest that spleen DCs and Foxp3+Tregs prevents the generation and activation of Th2 effector cells as a novel pathway of regulation of type immunity in asthma ... autologous CD4+ and CD8+ T cells were stimulated with the targeted DCs, the Wang et al Genetic Vaccines and Therapy 2010, 8:2 http://www.gvt-journal.com/content/8/1/2 Page of proliferation and cytokine ... significantly prevented by the vaccination with OVA-Fc-pcDNA3.1 Our pilot study showed that targeted DCs stimulated the proliferation of peripheral CD4+ T and CD8+ T cells in a concentration-dependent...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo y học: "Regulating the immune system: the induction of regulatory T cells in the periphery Jane H Buckner1 and Steven F Ziegler2" pot
... death, TR cells lead to the induction of T regulator (Tr1) cells and Th3 cells, which feed back to inhibit inflammation, and the TR cells inhibit proliferation of antigen-specific and bystander ... question: Do TR cells represent a lineage of T cells or a state of activation that may be achieved by any T cell under the appropriate conditions of activation? The induction of TR cells in the ... activation of CD4+CD25– T cells with mature, allogeneic dendritic cells, and these T cells also expressed FoxP3 The specificity of the TR cells was determined by the type of mature dendritic cells...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc
... demonstrate that Treg cells can inhibit arthritis development when transferred at the time of arthritis induction However, we were unable to demonstrate any therapeutic effect of Treg cell transfer ... 7b) The migration behaviour of CD4+CD25+ Treg cells does reflect their more activated phenotype, and their ability to enter inflamed joints makes it possible that they act directly at the site of ... of Treg cells [37] With this in mind, it could be interesting to investigate whether the accumulated Treg cells in patients with arthritis function properly in vivo and whether these patients...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Role of regulatory T cells in experimental arthritis and implications for clinical use" potx
... treatment decreases the infiltrate in joints Furthermore, RA patients relapse shortly after withdrawal of anti-TNF-α [19] and thus, despite the dampening of joint inflammation and the reinstatement of ... active RA before treatment with anti-TNF-α were unable to suppress proinflammatory cytokine secretion from activated T cells and monocytes After anti-TNF-α treatment the ‘hibernated’ peripheral ... for RA and other autoimmune diseases in the future Competing interests The author(s) declare that they have no competing interests References However, a recent study has proposed that anti-tumour...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps
... compared to normal peripheral blood T cells of this subpopulation Overall, this study contributes to our understanding of recruitment of T cells to the joint in inflammatory arthritis and suggests that ... contributing to this study and the clinical staff for help with collection of samples We thank members of the Information Systems Unit and Statistics Unit at ICH for advice with statistics and ... suggests that in the microenvironment of the joint, dysregulation of functional patterns of expression may occur Competing interests The authors declare that they have no competing interests Authors'...
Ngày tải lên: 09/08/2014, 07:20
báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx
... 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The PCR products were inserted into the pMD19 -T Simple Vector (Takara) using TA-cloning procedures, and ... with CHO/EGFP cells (C) Representative FACS scatter plots of apoptotic CD3 +T cells 72 h after co-culture with CHO cells transfected with IDO (D) Representative FACS scatter plots of apoptotic ... was used to identify the product of interest (pMD19IDO) Materials and methods To investigate IDO gene integration into CHO cells, total RNA was isolated from CHO cells transfected with pIRES2-EGFP-IDO...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: "Japanese Encephalitis Virus wild strain infection suppresses dendritic cells maturation and function, and causes the expansion of regulatory T cells" doc
... IFN-a and TNF-a was independent on viral replication DCs infected with P3 attenuated allostimulatory activities to T cells To test whether P3 infection will impair the ability of DCs to activate ... present antigen to and activate T lymphocytes through up-regulating the expression of costimulatory and antigen presentation-associtated molecules at the mature stage [17] To examine whether the characteristics ... acute or chronic infection because of the defect of APCs function for activating T cell [21-23] Therefore it suggested that the impairment of activating of allogeneic naïve T cells of P3 infected...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "Defective response of CD4+ T cells to retinoic acid and TGFb in systemic lupus erythematosus" ppt
... albeit incomplete, and have concluded that these cells represent an attempt to control active autoimmune activation [14] The size of the Treg compartment results from the combined contribution of ... between patients with active and inactive disease, or between patients that were treated or non-treated with steroids (data not shown) Differential distribution of expanded CD4+ T cell subsets ... correlation that we have found between the levels of memory T cells and Treg expansion by the combination of TGFb and RA in SLE patients suggests that at least the latter mechanism is defective, either...
Ngày tải lên: 12/08/2014, 17:22
The role of CD8 t cells in the differentiation of TNF iNOS producing dendritic cells and TH1 responses
... lymphocyte B cells and T cells are the major types of lymphocytes T cells provide important cell mediated immunity by participating in the cytolysis of infected cells through the recognition of antigen ... suggesting that CD8 T cells were vital for the polarization of Th1 cells This was also supported by studies demonstrating the involvement of CD8 T cells in the generation of protective CD4 Th1 ... promote the activation of DCs for anti-tumor effects (Fernandez et al., 1999) and viral immunity (Andrews et al., 2003) Activated NK cells produce TNF-α and IFN-γ that promotes DC maturation and Th1...
Ngày tải lên: 09/09/2015, 18:58
Post crystallisation treatment and characterisation of polycrystalline silicon thin film solar cells on glass
... Measured optical transmissions of the plastic foil without (blank) and with three different dot patterns The dot patterns are shown as insets The dot patterns were made with the Microsoft Word software ... approaches is the post-crystallisation treatment An RTA step at above 900 C is often added in the intermediate -T approach to anneal crystal defects and activate the dopants This process is not necessary ... concentration instead of the active doping concentration The SR method is simple and cheap, but it requires mechanical pre-treatment and has limitations with the depth resolution In contrast, the...
Ngày tải lên: 10/09/2015, 09:23
Alloreactive t cells and cytokines in murine graft versus host disease 5
... activity, and development of histopathological alterations Transplantation 44(2): 254-260 Gillis S, Ferm MM, Ou W, Smith KA 1978 T cell growth factor: parameters of production and a quantitative ... transplantation Transplantation 57(10): 1474-1479 Bishop DK and Orosz CG 1989 Limiting dilution analysis for alloreactive, TCGFsecretory T cells: two related LDA methods that discriminate between ... R, Diamantstein T 1987 Prolongation of rat pancreatic islet allograft survival by treatment of recipient rats with monoclonal anti-interleukin-2 receptor antibody and cyclosporin Diabetologia...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 4
... lymphocytes (characteristics of resting T cells) and found that although their in vitro anti-recipient cytotoxicity was very much lower than their activated counterparts, their capability of inducing ... histopathologic signs of GVHD These results showed that DT390-anti-CD3 IT has potent cytotoxicity against T cells and could be employed as a therapy to induce transplantation tolerance or treat ... conditions resulting in complete neutralization of its native counterpart, suggesting the feasibility of employing this truncated form of IT in the treatment of human diseases The DT390 moiety...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 3
... analyzed with flow cytometry on day post-transplantation Representative flow cytometric profiles show the percentage of donor T cells amongst the total isolated cells (a) and the percentage of proliferating ... Activated alloreactive T cells would infiltrate into target organs of acute GVHD We then examined the infiltration of T cells into the liver, a major target organ of acute GVHD, in SCID mice that were ... histocompatibility antigens of the recipient (Korngold et al., 1987; Sayegh et al., 1994) However, T cells in the graft also facilitate engraftment and contribute to immune reconstitution Depletion...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 2
... 5’- TAGCTTCTGATCGATGCATG–3’ Reverse 5’- TCTCATGCTAATCGATCGAT–3’ Forward 5’- TACTGCTACTGATCGACTGC–3’ Reverse 5’- ATCCATCTGGCTAGGTCAGG–3’ Forward 5’- CAACGCTATCGCGTCGGATC–3’ Reverse 5’- TCGCTACTTAGCTACTCGAT–3’ ... GCTGGAGAGCTACAAGAGGATCA 3’ Reverse primer: 5’ TCTCTCTTGAGCTTGGTGACAAAA 3’ 5’ CTACAGCTTCTTTGGGACACCTGCTGCT 3’ Forward primer: 5’ AGTGATAAGGAATGCACGATGCT 3’ Reverse primer: 5’ TGAGGTCTTTGAGGGATTTGTAGTG 3’ Probe: ... GGTCTACATCGATCGCTACT–3’ Forward 5’- ATAGACTCTCCGATATAGCT–3’ Reverse 5’- TAGCTATCGATCGATCGTAA–3’ Forward 5’- AACCTTTAGTACCCATGCCA–3’ Reverse 5’- CACCTGTAGCTAGCTGCTAG–3’ Forward 5’- TAGCTGTCAACTCGATCTCC–3’...
Ngày tải lên: 16/09/2015, 17:13
Alloreactive t cells and cytokines in murine graft versus host disease 1
... competent cells in the graft, the host appearing “foreign” to the graft, and the inability of the host to react sufficiently against the graft The interaction of donor cells and host target tissues ... IL-6 and nitric oxide These factors both increase APC stimulation of T cells and mediate the wasting and tissue damage of GVHD (Smith et al., 1991) 1.2.5 Predicting GVHD Both the extent of histoincompatibility ... Chemokines that attract effector and memory T cells After activation in the secondary lymphoid tissues by antigens, effector T lymphocytes emigrate, circulate through the blood system, and migrate to...
Ngày tải lên: 16/09/2015, 17:13
Perspectives of Chief Ethics and Compliance Officers on the Detection and Prevention of Corporate Misdeeds ppt
... retaliatory acts Still another participant noted that anti-retaliation efforts within companies, and the protection of whistleblowers, are intimately linked to many of the other functions that ... combination of government mandates, incentives, and standard-setting It remains to be seen whether the current financial meltdown in the U.S mortgage and banking sectors will ultimately be attributable, ... ethics and compliance program: Ultimately, prerequisites for protecting the interests of the organization itself, and for maintaining accountability to other stakeholders and to the public interest...
Ngày tải lên: 06/03/2014, 22:20
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third ... encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen ... interest in these molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity by site...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: "Automatic Detection and Correction of Errors in Dependency Treebanks" potx
... correction of errors, which consists out of the following steps: Automatic detection of error candidates, i.e cases where two parsers deliver results different to gold-standard Substitution of the ... Our result is that 619 tokens (45.9%) were different from the erroneous goldstandard That means that despite the fact that the training data contained some incorrectly annotated tokens, the parsers ... counts and therefore the variation detection would not work well in this scenario Actually, it was down only a few points at the time In this sentence the gold standard suggests points at ,...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... dehydration generates the quinonemethide from GOG (structure II) The reaction mixture turned yellow as a result of formation of the quinonemethide The scheme is consistent with the fact that the ... specificity of the Ca structure and p-hydroxyl group, the b-aryl ether cleavage enzyme could react with DHP-GOU This result indicates reactivity for the structure that retained the Ca alcohol and ... summarized in Table The EC was concentrated by ultrafiltration and applied to a gel-filtration column of Sephadex G-75 The fractions with the highest activity were collected and subjected to anion-exchange...
Ngày tải lên: 17/03/2014, 03:20