Molecular analysis of oxysterol binding proteins in yeast

... 2.4.2 The role of Osh proteins in maintaining sterol homeostasis………………… .29 26 2.4.3 The role of Osh proteins in membrane trafficking…………………………………30 27 2.4.4 Roles of Osh proteins in other cellular ... Factor; OB: Oxysterol Binding domain; O.D: Optical Density; OPI1: OverProduction of Inositol; ORD: OSBP Related Domain; ORP: OSBP Related Protein in humans; OSBP: Oxy...

Ngày tải lên: 16/09/2015, 08:31

... comparative immunoblotting data, it was of interest to re-examine the fate of calsequestrin by studying the entire complement of key Ca2+-binding elements in dystrophindeficient skeletal muscle fibres Because ... ÔStains-AllÕ was used to determine potential changes in the expression of major Ca2+-binding proteins in dystrophic fibres A comparison between the selecti...

Ngày tải lên: 19/02/2014, 16:20

... analysis of the amino acids located in the amino-terminal extensions that lie outside of the PUM-HD in AtPum proteins A comparison of the percentage of amino acid identity and similarity for the amino ... resulting in an amino acid triplet that matches that of Puf repeats and in the conserved proteins Interestingly, this CRQ triplet is also found in r...

Ngày tải lên: 12/08/2014, 03:21

... and Schroer, 2000) There are two types of kinesin, kinesin-1 and kinesin-2 Kinesin-1 is found to be involved in the transport of various organelles including Golgi complex (Lippincottschwartz et ... structure of the host genome, thus facilitating the inserting of T-DNA 1.4 The response of the host cells to Agrobacterium infection Similar to other pathogens, Agrobacter...

Ngày tải lên: 09/09/2015, 10:08

... Oxysterol- binding protein 22 Yeast OSBP homologues 25 1.3.1 Structure of Osh proteins 25 1.3.2 Localization of Osh proteins 27 1.3.3 Function of Osh proteins 27 1.3.3.1 Role of OSH in maintaining ... Deletion of VPS4 causes redistribution of Osh7p 3.2.1 73 77 79 Osh7p-GFP shows different staining pattern in wild-type and vps4∆ strains 3.2.2 71 79 In vivo pro...

Ngày tải lên: 03/10/2015, 20:57

... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGG...

Ngày tải lên: 16/10/2015, 11:57

... measure the mobility of the components in the PGCs The medaka embryo was peeled off the chorion, and the segment containing the part of PGCs was excised for observation by microscopy and FCS ... dynamic nature of the nuage Schematic diagram of the preparation of PGCs of medaka specimen (A) OlvasGFP was expressed in the medaka PGC at stage 24 and...

Ngày tải lên: 18/02/2014, 16:20

... the ligand specificity of family carbohydrate- binding modules J Biol Chem 275, 4113 7– 4114 2 30 Accelrys (1993) InsightII v 2.3.0 Accelrys, San Diego, CA Determinants of ligand specificity in CtCBM11 ... grouped into three subfamilies: ‘surface -binding CBMs (type A), ‘glycan-chain -binding CBMs (type B), and ‘small sugar -binding CBMs (type C) [5] Determinants...

Ngày tải lên: 18/02/2014, 17:20

... W16 5A W16 9A W17 8A L6 6A R6 7A R6 8A D6 9A I7 0A K7 2A C7 3A S16 2A I163Ab Y16 4A E16 6A D16 7A P16 8A R17 0A G17 2A R6 2A ⁄ K6 3A R6 7A ⁄ R6 8A R6 7A ⁄ R6 8A ⁄ K7 2A K15 9A ⁄ K16 0A a )MgCl2 ss Normal conditiona ss ... ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japan) and /X174 cir...

Ngày tải lên: 06/03/2014, 09:22

... 2675 Actin and ABPs in transcription regulation B Zheng et al Table Role of nuclear actin- binding proteins interacting with the androgen receptor AR, androgen receptor; LBD, ligand-binding domain ... STARS-interacting proteins These novel proteins contain four LIM domains and a C-terminal villin headpiece domain, which mediates actin- binding in several proteins,...

Ngày tải lên: 07/03/2014, 01:20

... by mTORC1 [4,5,7 ,18 ,19 ] The first proteins shown to contain functional TOS motifs were the ribosomal protein S6 kinases (S6Ks) and the eukaryotic initiation factor (eIF) 4E-binding proteins (4E-BPs; ... 4E-BP1 (1 11 7) in the overlay assay Reproducibly, two regions appeared to be involved in assisting the binding to raptor: the first 17 amino acids [compare the...

Ngày tải lên: 16/03/2014, 06:20

... the pyranopterin part of the cofactor is somehow defective in Qor from strain KT2440 pUF1 UV/Visual spectra of the Qor proteins from P putida 86, P putida KT2440 pUF1 and P putida 86-1 Dqor pUF1 ... putida 86-1 Dqor pUF1 is not able to grow on quinoline as a sole source of carbon Kinetic properties of the Qor proteins from P putida...

Ngày tải lên: 17/03/2014, 10:20

... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were per...

Ngày tải lên: 30/03/2014, 11:20

... (IGF1R): Insulin-like Growth Factor- 1 receptor; (IGFBP-3): Insulin-like Growth Factor Binding Protein-3; (IGFBP-4): Insulin-like Growth Factor Binding; Protein-4; (MAPK): Mitogen-activated protein kinase; ... role of secreting IGFBPs in melanoma However, data not support the clinical utility of measuring levels of IGFBP-3 and -4 in sera of melan...

Ngày tải lên: 18/06/2014, 15:20

... loading Results BPA induces dose dependent apoptosis in acute myeloid leukemia cells To understand the potential role of BPA in biological systems of leukemias we tested the action of BPA in three ... activity of these compounds [17,18] In the present manuscript, we decided to investigate the effects of different doses of BPA on acute myeloid l...

Ngày tải lên: 18/06/2014, 15:20