Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein Tokiha Masuda 1,2 , Feng Ling 2 , Takehiko Shibata 1,2 and Tsutomu Mikawa 1,2,3 1 Graduate School of Nanobioscience, Yokohama City University, Japan 2 RIKEN Advanced Science Institute, Saitama, Japan 3 RIKEN SPring-8 Center, Hyogo, Japan Introduction Homologous DNA recombination is conserved in all organisms. In the nucleus, homologous recombination is involved in the maintenance of genome integrity during mitosis, and in genetic diversification through meiosis. In bacteria, homologous recombination strictly depends on the RecA gene [1–4], whereas in eukaryotes it depends on the Rad51 [5–8] and Dmc1 [9–12] genes, both of which encode RecA orthologs. Homologous recombination is initiated via a single- stranded gap or a double-strand break, which is processed to produce 3¢-ssDNA tails [13]. Each ssDNA region invades undamaged homologous dsDNA, resulting in the formation of homologous joints between the dsDNA and ssDNA through the pairing of complementary sequences. This reaction is termed homologous pairing (HP), and it is followed by a strand exchange to stabilize the joint [1,14]. The RecA ⁄ Rad51 family of proteins promotes HP, which is a key process of homologous recombination, in an ATP-dependent manner in vitro. Keywords fluorescence resonance energy transfer (FRET); homologous recombination; Mhr1; mtDNA; RecA Correspondence T. Mikawa, RIKEN Advanced Science Institute, 1-7-29 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045, Japan Fax: +81 45 5087364 Tel: +81 45 5087224 E-mail: mikawa@riken.jp (Received 6 October 2009, revised 24 December 2009, accepted 8 January 2010) doi:10.1111/j.1742-4658.2010.07574.x The Mhr1 protein is necessary for mtDNA homologous recombination in Saccharomyces cerevisiae. Homologous pairing (HP) is an essential reaction during homologous recombination, and is generally catalyzed by the RecA ⁄ Rad51 family of proteins in an ATP-dependent manner. Mhr1 cata- lyzes HP through a mechanism similar, at the DNA level, to that of the RecA ⁄ Rad51 proteins, but without utilizing ATP. However, it has no sequence homology with the RecA ⁄ Rad51 family proteins or with other ATP-independent HP proteins, and exhibits different requirements for DNA topology. We are interested in the structural features of the func- tional domains of Mhr1. In this study, we employed the native fluorescence of Mhr1’s Trp residues to examine the energy transfer from the Trp resi- dues to etheno-modified ssDNA bound to Mhr1. Our results showed that two of the seven Trp residues (Trp71 and Trp165) are spatially close to the bound DNA. A systematic analysis of mutant Mhr1 proteins revealed that Asp69 is involved in Mg 2+ -dependent DNA binding, and that multiple Lys and Arg residues located around Trp71 and Trp165 are involved in the DNA-binding activity of Mhr1. In addition, in vivo complementation anal- yses showed that a region around Trp165 is important for the maintenance of mtDNA. On the basis of these results, we discuss the function of the region surrounding Trp165. Abbreviations dnRad54, Danio rerio Rad54; FRET, fluorescence resonance energy transfer; HP, homologous pairing; essDNA, etheno-ssDNA. 1440 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS MHR1 is necessary for the homologous recombina- tion of mtDNA in Saccharomyces cerevisiae. The mhr1-1 mutation causes defects in mtDNA duplication, partitioning to bud, and recovery of homoplasmy, all of which are attributed to the MHR1-dependent initia- tion of rolling-circle mtDNA replication. This process occurs through HP, followed by continuous copying of the complementary sequence of the circular parental dsDNA [15,16]. The MHR1 gene product, Mhr1, con- sists of 226 amino acids, binds to both ssDNA and dsDNA, and catalyzes HP in an ATP-independent manner in vitro [15,17,18]. In addition to Mhr1, other proteins that promote HP in an ATP-independent manner have been identi- fied. These HP proteins include the human Xrcc3– Rad51c ⁄ Rad51L2 complex (human Rad51 paralogs [19]), human Rad52 [20], Escherichia coli phage k b-protein [21], E. coli RecT (a homolog of kb-protein [22]), E. coli RecO [23], and Ustilago maydis Brh2 [24]. The amino acid sequences and tertiary and quaternary structures of these ATP-independent HP proteins are different from those of the RecA ⁄ Rad51 family pro- teins, and no sequence homologies have been found among them. HP catalyzed by RecA ⁄ Rad51 is accom- panied by the untwisting of the dsDNA substrate, and is strongly stimulated by negative supercoils of the dsDNA. In contrast, HP by Mhr1 is performed with- out a net change in the number of dsDNA twists and is prevented by negative supercoils [25]. However, we have recently found that RecA ⁄ Rad51 and Mhr1 cause similar structural changes in the ssDNA, which sug- gests that they may operate via a common mechanism at the DNA level [26]. In order to understand the mechanisms of HP, it will be crucial to determine how each HP protein causes a similar structural change in the DNA. These investigations should include the identification and characterization of the DNA-binding regions and the binding modes of each of these mole- cules. In this study, we analyzed the Mhr1 sites involved in ssDNA binding, using fluorescence analysis and site-directed mutagenesis. In a detailed homology search, we also found that Mhr1 shows partial sequence similarity to the core helicase domain of Rad54. Finally, we discuss the DNA-binding mode of Mhr1 and a potential mechanism for HP. Results Quenching of Trp fluorescence after DNA binding Mhr1 has seven Trp residues (Fig. 1A) and 11 Tyr residues. Therefore, we examined the binding of Mhr1 to DNA by measuring changes in the fluorescence spectra of Mhr1 after binding. To distinguish the fluorescence of Trp from that of Tyr, we selected an excitation wavelength of 295 nm, because the absorp- tion associated with Tyr is negligible at this wave- length. This allowed for the selective examination of fluorescence from Trp residues [27]. The fluorescence emission spectra of Mhr1 in the presence and absence of ssDNA exhibited peaks around 350 nm (Fig. 1B). The emission spectrum of Mhr1 was quenched when a 74-mer ssDNA was added. Ultimately, the fluorescence intensity decreased to  60% of the initial intensity (Fig. 1B). The fluorescence change was saturated at an ssDNA concentration that was 16-fold greater than the Mhr1 concentration (8 lm nucleotide⁄ 0.5 lm 160 140 120 100 80 60 40 20 0 ssDNA (µM) Fluorescence change at 350 nm 305 350 400 450 500 350 300 250 200 150 100 50 0 Wavelength (nm) Fluorescence intensity 0246810121416 Residue No. 15 59 71 120 165 169 178 A B C Fig. 1. Fluorescence changes of Mhr1 after ssDNA binding. (A) Schematic representa- tion of the positions of the Trp residues in Mhr1. (B) Emission spectra of wild-type Mhr1 (0.5 l M) with varying concentrations of the 74-mer oligo-ssDNA (light gray to black: 0, 2, 4, 6, 8 and 15 l M). (C) Fluores- cence changes of Mhr1 at 350 nm after ssDNA binding. Measurements were per- formed three times. T. Masuda et al. DNA-binding sites of Mhr1 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS 1441 protein; Fig. 1C). These results imply that the environ- ment of some of the Trp residues changed after the binding of Mhr1 to the 74-mer ssDNA. This fluores- cence quenching was also observed in the presence of shorter ssDNA (a 50-mer and a 34-mer), whereas no quenching was induced by a 27-mer ssDNA (data not shown), probably because it was too short for Mhr1 binding. The use of a circular ssDNA molecule as a substrate (/X174) hampered clear measurement of the Mhr1 fluorescence spectrum, probably because of scat- tering from the large Mhr1–ssDNA complex (data not shown). Although the Trp environment was most likely affected by the proximity of the DNA, other possibilities can also be envisioned, such as a confor- mational change in Mhr1 upon DNA binding. Mhr1 may interact with Mhr1 on the DNA, although it existed as a monomer in solution (unpublished result). In this case, the quenching of Trp fluorescence may occur if some Trp residues are located near the protein–protein interface. Fluorescence resonance energy transfer (FRET) from Mhr1 to etheno-ssDNA (essDNA) Fluorescence-based assays including FRET analysis have been applied to the investigation of the nucleo- tide-binding sites of E. coli RecA [28], T4 phage GP32 [29], and human Rad51 [30]. To examine whether any Trp residues of Mhr1 are close to the DNA molecule in the Mhr1–ssDNA complex, we measured the energy transfer from the Trp residues to the fluorescent nucle- obase ethenoadenine, which is a fluorescent analog of the adenine nucleotide. The emission spectrum of Trp overlaps partially with the absorption spectrum of essDNA. Therefore, FRET could be used to evaluate whether a Trp residue was close to the essDNA. The seven Trp residues of Mhr1 are distributed almost evenly throughout the polypeptide chain (Fig. 1A). Thus, a FRET analysis of Mhr1 variants with muta- tions at the Trp sites should provide information about the ssDNA-binding region of Mhr1. After the addition of various amounts of essDNA, we observed signifi- cant quenching of Trp fluorescence at 350 nm and a new peak at 390 nm (Fig. 2A), which were considered to be caused by FRET from Trp to essDNA. As Trp fluorescence was quenched upon DNA binding (Fig. 1B), the emission spectra must have comprised the fluorescence from both quenching and energy transfer. Therefore, energy transfer from Mhr1 to essDNA was examined as described previously [29]. When the fluorescence changes at 350 nm in the Mhr1–essDNA complex were compared with those in the Mhr1-unmodified DNA complex, essDNA quenched over 60% of Trp fluorescence, whereas unmodified DNA quenched < 40% (Fig. 2A, inset). The addition of essDNA caused over a 1.5-fold decrease in fluorescence intensity as compared with unmodified DNA. Thus, FRET from Trp residues to essDNA was confirmed (Fig. 2A, inset). The changes in fluorescence intensity (DI) at 350 nm and 390 nm after essDNA binding were plotted against the concen- tration of essDNA (Fig. 2B,C). Again, the changes in fluorescence at 350 and 390 nm were saturated at a DNA ⁄ Mhr1 concentration ratio of approximately 16 : 1 (7.8 lm nucleotide ⁄ 0.5 lm protein), which was equal to the saturation ratio obtained using unmodi- 305 350 400 450 500 Wavelength (nm) Fluorescence intensity 250 200 150 100 50 0 160 120 80 40 0 ΔI εssDNA (μM) At 350 nm 0 2.6 5.2 7.8 10.4 13 15.618.2 At 390 nm 160 120 80 40 0 ΔI εssDNA (μM) 0 2.6 5.2 7.8 10.4 13 15.6 18.2 0 1 0.8 0.4 0 5 10 15 20 DNA (μ M) Relative intensity At 350 nm A B C Fig. 2. Energy transfer from the Trp resi- dues of Mhr1 to essDNA. (A) Mhr1 (0.5 l M) was incubated with varying concentrations of essDNA (light gray to black: 0, 2.6, 5.2, 7.8, 10.4, 13, 15.6 and 18.2 l M)at25°C for 10 min. These samples were excited at 295 nm. The inset shows the relative fluorescence changes at 350 nm against the DNA concentrations of the Mhr1–essDNA complex (filled circle) and Mhr1-unmodified DNA complex (open circle). Changes in fluorescence intensity at 350 nm (B) and 390 nm (C) were plotted against essDNA concentration. Measurements were performed three times. DNA-binding sites of Mhr1 T. Masuda et al. 1442 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS fied ssDNA (Fig. 1B). This result suggested that the fluorescence modification of ssDNA employed here did not affect the DNA-binding activity of Mhr1. FRET of Mhr1 mutants To identify the Trp residues of Mhr1 that contribute to the observed FRET, each of the seven Trp residues was replaced by an Ala, a general candidate for site- directed mutagenesis. Additionally, Ala is uncharged, and does not absorb light at 295 nm. Two of these mutants (W15A and W71A) precipitated during the purification process, so those Trp residues were replaced by Phe, which is structurally similar to Trp but negligibly excited at 295 nm. The seven Mhr1 mutants (W15F, W59A, W71F, W120A, W165A, W169A, and W178A) were produced in E. coli and purified using a method similar to the one used to purify wild-type Mhr1. Figure 3 shows the relative flu- orescence emission spectra of the seven Mhr1 mutants in the presence of essDNA. Although all mutants exhibited energy transfers, the decrease in fluorescence intensity at 350 nm was much smaller for the W71F and W165A mutants than it was for the wild type and other mutants (Fig. 3, gray vertical broken line). This indicated that the W71F and W165A mutants trans- ferred energy with less efficiency than the wild type, and that Trp71 and Trp165 together contributed significantly to the energy transfer in the wild type. The results strongly suggested that the DNA-binding site of Mhr1 occurs near Trp71 and ⁄ or Trp165. As the fluorescence intensity at 390 nm (Fig. 3, gray vertical solid line) increased after essDNA addition, even with the W71F and W165A mutants, the ability of these mutants to bind ssDNA was expected to be similar to that observed for the other mutants. To con- firm this hypothesis, the DNA-binding activity of each mutants was examined at various protein concentra- tions. In the absence of Mhr1, no band shift was detected (arrowheads in Fig. 4). In the presence of 0.5 lm Mhr1 for ssDNA and 1 lm Mhr1 for dsDNA, the Mhr1–DNA complexes exhibited a complete gel mobility supershift (arrows in Fig. 4). In the presence of 0.25 lm Mhr1, about half of the ssDNA complexes exhibited the supershift (arrows in Fig. 4). For both ssDNA and dsDNA, the protein ⁄ DNA molecular ratios required to obtain about a half-shift were approximately 1 : 40 (Figs S1 and S2). Finally, all of the mutants showed complete shifts at concentrations of 0.5 lm (ssDNA) and 1 lm (dsDNA). No mutant showed weaker DNA-binding activity than the wild type, although there were slight differences in their binding activities. These results suggest that no Trp res- idue was directly involved in DNA binding, and that 80 60 40 20 0 100 80 60 40 20 0 100 80 60 40 20 0 100 Wavelen g th (nm) 400350 450 500 Wavelength (nm) 400350 450 500 400350 450 500 300300 300 Relative fluorescence intensity (%) A95Wtw W15F W120A W165A W71F W178AW169A Fig. 3. Energy transfer from the Trp resi- dues of Mhr1 mutants to essDNA. The emission spectra of Mhr1 (1 l M) mutants were measured in the presence of 0 l M (solid line), 5.2 lM (dotted line; this concen- tration causes roughly a 50% change in each fluorescence spectrum) and 10.4 l M (broken line) essDNA, and were plotted as relative intensities that were defined as percentages of the intensity of the Mhr1 mutants alone (i.e. 100%). T. Masuda et al. DNA-binding sites of Mhr1 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS 1443 the reduction in the efficiency of FRET in the presence of the W71F or W165A mutants was not due to defects in the DNA-binding activities of these mutants. DNA-binding activities of Mhr1 mutants To examine the effects on DNA-binding activity of single amino acid substitutions around Trp71 and Trp165 of Mhr1, the following mutants were prepared and their DNA-binding activities were measured: L66A, R67A, R68A, D69A, I70A, K72A, C73A, S162A, I163A, Y164A, E166A, D167A, P168A, R170A, and G172A. The I163A mutant became aggre- gated during the purification process and was not studied further. All mutants exhibited DNA-binding activities that were comparable to that of the wild type in standard buffer conditions (FMG1 buffer) (Figs S1 and S2). These results indicated that it is difficult to obtain DNA-binding-defective mutants using single- site mutations. There are many basic amino acids in these two regions (Arg62, Lys63, Arg67, Arg68, Lys72, Lys159, Lys160, and Arg170), and multiple residues may interact with the DNA substrates. Therefore, we prepared Mhr1 mutants that each contained two or more substitutions of basic residues around Trp71 or Trp165, and examined their DNA-binding activities. wt W59A W120A W165A W169A W178A MMMMMM MM W15F W71F wt M ssDNA (10 μ M) ccc Well oc Well Lane No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Well Well Lane No. 19 20 21 22 23 24 25 26 27 dsDNA (7 μ M) ssDNA (10 μ M) dsDNA (7 μ M) 0 0. 25 0 . 5 0 0. 25 0 . 5 0 0. 25 0 . 5 0 0. 25 0 . 5 0 0. 25 0 . 5 0 0. 25 0 . 5 0 0. 25 0 . 5 0 0. 25 0 . 5 0 0 . 25 0 . 5 [Mhr1], μ μ M [Mhr1], μ μ M with 1 mM MgCl 2 MMMMMM 01 2 210210210210210 MMM 01 2 01 2 012 ccc [Mhr1], μ μ M [Mhr1], μ μ M Fig. 4. DNA-binding activity of the Mhr1 Trp to Ala ⁄ Phe variants. Circular ssDNA of / X174 (10 l M) or circular dsDNA of pUC18 (7 l M) in FMG1 buffer was incubated with Mhr1 mutants (0, 0.25 and 0.5 l M for ssDNA; 0, 1 and 2 l M for dsDNA) at 25 °C for 10 min. The arrowheads indicate the position of the original DNA band. The arrows indicate supershifted Mhr1–DNA complexes (nucleoprotein) stacked in the wells. oc, open circular dsDNA; ccc, cova- lently closed circular dsDNA; M, molecular mass marker (k HindIII). DNA-binding sites of Mhr1 T. Masuda et al. 1444 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS The relative DNA-binding activities were assessed by comparing the amounts of DNA remaining at the original positions (ssDNA and dsDNA are indicated by filled and open arrowheads in Fig. 5) and the amounts of DNA showing intermediate shifts (signals between the arrowheads and arrows in Fig. 5). Among the double-site and triple-site mutants prepared, the R67A ⁄ R68A ⁄ K72A and K159A ⁄ K160A mutants exhibited clear defects in DNA binding (Fig. 5A), although their DNA-binding activities were not completely lost. We also examined the DNA-binding activity of Mhr1 in the absence of Mg 2+ , because the DNA- binding activities of other HP proteins are often increased by the addition of Mg 2+ in vitro [31,32]. In the presence of 10 mm EDTA, which is a metal ion- chelating agent, higher concentrations of Mhr1 were required for DNA binding than in conditions that K72A M C dsDNA (5 μ M) ssDNA (10 μ M) well R67A/ R68A R62A/ K63A well wt R67A/R68A/K72A ssDNA (10 μ M) well well M C dsDNA (5 μ M) K159A/K160A [Mhr1], μ M 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 wt R67A/R68A/K72A ssDNA (10 μ M) well well M C dsDNA (5 μ M) K159A/K160A 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 with 1 mM MgCl 2 with 10 mM EDTA with 10 m M EDTA [Mhr1], μ M [Mhr1], μ M [Mhr1], μ M [Mhr1], μ M 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 . 2 0 . 4 0 . 6 0 . 8 1 . 0 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 0 . 1 0 . 2 0 . 3 0 . 4 0 . 6 5 mM Mg 2+ 10 mM EDTA dsDNA (10 μ M) ssDNA (5 μ M) [Mhr1], μ M 100 80 60 40 20 0 Mhr1 (μM) Relative fluorescence change (%) at 400 nm 0 0.5 1.0 1.5 2.0 2.5 3.0 10 mM Mg 2+ 10 mM EDTA εssDNA (13 μM) well well 0 0 . 1 2 5 0 . 2 5 0 . 5 1 0 0 . 1 2 5 0 . 2 5 0 . 5 1 0 0 . 1 2 5 0 . 2 5 0 . 5 1 0 0 . 1 2 5 0 . 25 0 . 5 1 E166A D167Awt D69A [Mg 2+ ], mM dsDNA (10 μ M) ssDNA (45 μ M) M well well 01510 01510 01510 01510 01510 01510 01510 01510 Mhr1 (0.5 μ M) Mhr1 (0.25 μ M) A B C F D E Fig. 5. DNA-binding activity of the Mhr1 Lys ⁄ Arg to Ala variants. (A) Gel mobility shift assay in the presence of Mg 2+ . Circular ssDNA of / X174 (10 l M) or circular dsDNA of pUC119 (5 lM) was incubated with the Mhr1 mutants (0.2, 0.4, 0.6, 0.8 and 1.0 lM for ssDNA; 0.1, 0.2, 0.3, 0.4 and 0.6 l M for dsDNA) in FMG1 buffer at 25 °C for 10 min. (B) Mg 2+ -dependent DNA-binding activity of Mhr1. Circular ssDNA of / X174 (5 l M) or circular dsDNA of pUC119 (10 lM) was incubated with 0.125, 0.25, 0.5 and 1 lM Mhr1 in T buffer in the presence of 10 mM EDTA (left) or 5 mM MgCl 2 (right) at 23 °C for 30 min. (C) Relative fluorescence changes of essDNA (13 lM) at 400 nm. essDNA (10 lM) was incubated with varying concentrations of Mhr1 (0, 0.2, 0.4, 0.5, 0.8, 1.6 and 3.0 l M)in25mM Tris ⁄ HCl (pH 7.5) in the presence of 10 m M MgCl 2 or 10 mM EDTA at 23 °C for 30 min. These samples were excited at 320 nm. Measurements were performed three times. (D, E) Gel mobility shift assay in the absence of Mg 2+ . The same samples used in (A) were incubated in T buffer with 10 mM EDTA at 23 °C for 30 min. (F) DNA-binding activity of the Mhr1 Asp ⁄ Glu to Ala variants in the presence of varying concentrations of Mg 2+ [0 (contained 10 m M EDTA), 1, 5 and 10 mM MgCl 2 ). Circular ssDNA (45 lM, top) or circular dsDNA (10 lM, bottom) was incubated with 0.5 lM (for ssDNA) or 0.25 l M (for dsDNA) of the Mhr1 mutants in T buffer at 23 °C for 30 min. The arrows indicate supershifted Mhr1–DNA com- plexes (nucleoprotein) stacked in wells. The arrowheads indicate the original position of DNA. M, molecular mass marker (k HindIII); C, no-protein control. T. Masuda et al. DNA-binding sites of Mhr1 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS 1445 included 5 or 10 mm MgCl 2 (Fig. 5B,C). Therefore, the DNA-binding activity of Mhr1 was considerably increased in the presence of MgCl 2 , although Mg 2+ mainly affects dsDNA binding. All of the Mhr1 mutants tested exhibited weaker DNA-binding activi- ties in the presence of 10 mm EDTA than in the pres- ence of Mg 2+ (compare Fig. 5D,E with Fig. 5A). In the presence of EDTA, the R67A ⁄ R68A ⁄ K72A and K159A ⁄ K160A mutants also showed DNA-binding defects, especially for ssDNA (Fig. 5D). In addition, we could detect DNA-binding deficiencies in other Mhr1 mutants that showed no defects in the presence of MgCl 2 . Whereas the R62A ⁄ K63A mutant was DNA-binding proficient, the K72A mutant showed slightly weaker DNA-binding activity than the wild type, especially for ssDNA, and the R67A ⁄ R68A mutant showed a clearer defect (Fig. 5E). These results suggest that the various Lys and Arg residues form a series of positively charged surfaces at which Mhr1 interacts with DNA. They also suggested the presence of multiple DNA-binding sites (at least two sites near Trp71 and Trp165) on Mhr1. These may explain our difficulty in obtaining a DNA-binding- deficient mutant via a single-site mutation. Next, we focused on the Mg 2+ -dependent DNA- binding activity of Mhr1, as Mg 2+ increased the DNA- binding activity of Mhr1. The enhanced DNA-binding activity could be due to the shielding of negative charges around the Mhr1–DNA interface by Mg 2+ ions. Alternatively, Mhr1 could interact with DNA not only via its positively charged residues, Lys and Arg, as discussed above, but also via Mg 2+ ions. To further explore the effects of charged amino acids on DNA binding, we replaced the acidic amino acids surround- ing Trp71 and Trp165 with Ala, and examined the binding activities of these mutants. The E166A and D167A mutants exhibited higher affinities for both ssDNA and dsDNA than the wild type (Fig. 5F), prob- ably because the mutations reduced the negative charge, which generally repels the negatively charged DNA backbone. However, the D69A mutant, which also had a decreased negative charge, exhibited weaker DNA-binding affinity than the wild type (Fig. 5F). At the highest concentration of MgCl 2 (10 mm), the dsDNA in the presence of the D69A mutant remained at its original position, whereas the wild type and the E166A and D167A mutants produced almost complete supershifts (open arrowhead in Fig. 5F). The D69A mutant showed slightly weaker ssDNA-binding affinity than the wild type (filled arrowhead in Fig. 5F), whereas the E166A and D167A mutants exhibited higher ssDNA-binding affinities than the wild type (lane corresponding to 1 mm Mg 2+ in Fig. 5F). These results suggest that Asp69 is among the residues that are important for the Mg 2+ -dependent DNA binding of Mhr1. The DNA-binding activities of all the Mhr1 variants examined are summarized in Table 1. In vivo complementation assay The mhr1-1 yeast mutant is the only functionally defective (in vivo) MHR1 mutant isolated to date. It has defects in mtDNA recombination, which is neces- sary for the maintenance of mtDNA. The mutant gene product has a single amino acid replacement (G172D) and exhibits defects in HP in vitro [18]. In this study, we demonstrated that Trp165, near Gly172, is close to the DNA in the Mhr1–DNA com- plex. Therefore, we expected that the region surrounding Trp165 would also play an important role in vivo. To test this hypothesis, we used the Mhr1 mutant proteins that had amino acid replace- ments in this region in complementation assays with the mhr1-1 mutant cells (FL67-1423 [18]). Comple- mentation was evaluated by examining the respiration defect phenotype (see Experimental procedures). The mhr1 mutant constructs were overexpressed in the yeast mhr1-1 cells using pRS416 vectors (Table 2 [17]). The mhr1-1 cells that were transformed with empty vector failed to grow on glycerol medium [yeast extract ⁄ peptone ⁄ glycerol (YPGly)] at a nonper- missive temperature (37 °C). However, mhr1-1 cells that expressed wild-type MHR1 grew under these conditions (Fig. 6). The mhr1-1 cells transformed with the S162A, Y164A and P168A mutants also grew on YPGly at 37 °C, whereas the cells transformed with the other mutants did not (Fig. 6; Table 2). These results suggest that Ile163, Trp165, Glu166, Asp167, Trp169, Arg170 and Gly172 play a role in mtDNA maintenance in vivo. This high frequency of important residues around Trp165 (seven of 10 residues) may be related to the fact that Trp165 is located near the DNA-binding site (see Discussion). A search for proteins with homology to Mhr1 To date, there have been no reports on the three- dimensional structure of Mhr1 or on any sequence or structural homology between Mhr1 and other proteins. Therefore, the functional domains of Mhr1 are difficult to predict. To acquire structural information on Mhr1, we performed a detailed homology search. Unexpect- edly, we found that the central portion of Mhr1 (resi- dues 77–217) exhibits sequence homology with the C-terminal RecA-like domain of zebrafish (Danio rerio) Rad54 (dnRad54) (residues 510–649), suggesting that DNA-binding sites of Mhr1 T. Masuda et al. 1446 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS Mhr1 shares a RecA-like domain with dnRad54 (Fig. 7A). The identity and similarity in this region were 22.0% and 42.6%, respectively (the similarity matrix used was BLOSUM62). Discussion In this study, we demonstrated that two distinct regions of Mhr1, a region around Trp165 (containing Lys159 and Lys160) and one around Trp71 (containing Arg67, Arg68, Asp69, and Lys72), are important in DNA recognition, and that Mhr1 has partial homology with dnRad54, a conserved protein involved in Rad51-medi- ated homologous recombination [33,34]. Rad54 contains an SWI2 ⁄ SNF2 chromatin-remodeling domain that includes two RecA-like helicase domains (Fig. 7B [35]). The cleft between the two RecA-like helicase domains is predicted to be a DNA-binding surface [35,36]. This feature is also found in other superfamily 1 and superfamily 2 helicases (e.g. RecQ, UvrB, RecG, and PcrA) [37–39]. The first RecA-like domain, which is positioned at the N-terminus of dnRad54, contains a putative ATP-binding site (WalkerA motif); however, the second RecA-like domain, positioned at the C-termi- nus, does not [35]. Mhr1 exhibits sequence homology with the second RecA-like domain of dnRad54. This Table 2. Effect of the mutations surrounding Trp165 on the growth of mhr1-1 cells. Vector name Mutation Growth on YPGly plates at 37 °C pRS416CM_162 S162A + pRS416CM_163 I163A ) pRS416CM_164 Y164A + pRS416CM_165 W165A ) pRS416CM_166 E166A ) pRS416CM_167 D167A ) pRS416CM_168 P168A + pRS416CM_169 W169A ) pRS416CM_170 R170A ) pRS416CM_172 G172A ) pRS416CM Wild type + pRS416 Control vector ) Table 1. DNA-binding activity of the Mhr1 variants. N, DNA-binding activity is comparable to that of the wild type; +, DNA-binding activity is slightly stronger than that of the wild type; +++, DNA-binding activity is clearly stronger than that of the wild type; ), DNA-binding activity is slightly weaker than that of the wild type; ))), DNA-binding activity is clearly weaker than that of the wild type; )), DNA-binding activity is weaker than that of the wild type. Normal condition a )MgCl 2 +MgCl 2 Mutant name ss ds ss ds ss ds Fig. no. W15F N N 4 W59A N N 4 W71F N N 4 W120A N N 4 W165A N N 4 W169A N N 4 W178A N N 4 L66A + + S1 R67A N ) S1 R68A N N S1 D69A N N ) ))) S1, 5F I70A N N S1 K72A N N ) N S1, 5E C73A + + S1 S162A N N S2 I163A b Y164A + N S2 E166A + N + + + + + + S2, 5F D167A N N + + + + + + S2, 5F P168A N N S2 R170A N N S2 G172A N N S2 R62A ⁄ K63A N N 5E R67A ⁄ R68A ))) ))) 5E R67A ⁄ R68A ⁄ K72A ))) ))) ))) )) 5A,D K159A ⁄ K160A ))) ))) ))) )) 5A,D a 25 mM Mes (pH 6.5), 1 mM MgCl 2 , and 1 mM dithiothreitol. b Protein aggregated during the process of purification. T. Masuda et al. DNA-binding sites of Mhr1 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS 1447 finding is consistent with the absence of the requirement for ATP in Mhr1-catalyzed HP [18]. RecA-like domains, some of which have an aromatic- rich loop, generally consist of several parallel b-sheets, and a-helices that surround the b-sheets. The aromatic- rich loop in the first RecA-like domain of RecQ is important for the linking of ATP hydrolysis to DNA binding ⁄ unwinding [40]. Amino acid substitutions in the aromatic-rich loop of RecQ modify its ATP hydrolysis activity and reduce its DNA-unwinding (helicase) activ- ity [40]. The crystal structure of the PcrA–DNA com- plex shows that the residues of the aromatic-rich loop stack with a base in the ssDNA [41]. In this study, we found that the region around Trp165 of Mhr1 has an aromatic-rich sequence (residues 163–167: IYWED), is close to the DNA, and is important for the maintenance of mtDNA in vivo (Figs 3, 5 and 6; Table 1). There is no evidence indicating that the aromatic-rich region of Mhr1 forms a loop; however, this region may function in a fashion similar to that of RecQ and ⁄ or PcrA. The L2 loop of E. coli RecA, a DNA-binding region, has also been examined by mutagenesis and FRET analysis [28]. Although F203W, a mutation in the central region of the L2 loop, would be close to DNA, a large FRET from Trp203 to poly(deoxy-ethenoadenine) was not observed, probably because of their unfavorable relative orientations. This notion is supported by the recent crys- tal structure of the RecA–ssDNA complex, which shows that the side chain of Phe203 is oriented vertically towards the DNA bases, although the bases and side chain are in close proximity to each other [42]. There- fore, Trp165 (and also Trp71) of Mhr1 may be oriented horizontally towards the DNA bases, a condition favor- able for FRET. Homology modeling of the Mhr1 core (residues 77– 217), based on the sequence alignment between Mhr1 and dnRad54 (Fig. 7A), predicted that Mhr1 has a RecA-like helicase domain (Fig. 7C). In the model, the aromatic-rich region (residues 163–167) forms a loop that protrudes from the core structure (Fig. 7C; Fig. S3). Thus, the model structure supports the exis- tence of an aromatic-rich loop in Mhr1. The proteins with the mutations E166A and D167A in the aro- matic-rich region, which led to the loss of negative charges, exhibited higher affinities for DNA than the wild type (Fig. 5). In contrast, the protein with the K159A ⁄ K160A double mutation, which led to the loss of positive charges, showed weaker affinity for DNA than the wild type. Therefore, after DNA binding, this region would form a structure that recognizes the neg- atively charged sugar–phosphate DNA backbone. The strong defect of mhr1-1 (G172D) may also be due to the introduction of a negative charge in this region. Regarding the region around Trp71, Asp69 seems to interact with DNA via Mg 2+ (Fig. 5F), whereas Arg67, Arg68 and Lys72 interact directly with the DNA (Fig. 5). Therefore, these residues form a positively charged surface that interacts with the sugar–phosphate backbone. However, we could not predict the spatial orientation and the tertiary structure of this region, as there was no sequence homology between this region and dnRad54 or any other protein in the database. On the basis of the results from this study, we pro- pose that the regions around Trp71 (especially Arg67, Arg68, Asp69, and Lys72) and Trp165 (especially Lys159 and Lys160) of Mhr1 interact with DNA, and that the region around Trp165 (i.e. the putative aro- matic-rich loop) may undergo a conformational change that occurs after DNA binding. This conformational change may be important for Mhr1 function, although this will have to be confirmed via the elucidation of the tertiary structure of Mhr1. SD-Uracil YPGly 30 °C YPGly 37 °C wt c 162 163 164 165 167 168 169 170 172 178 166 Fig. 6. In vivo complementation experiments in mhr1-1 cells using the mhr1 mutants with changes surrounding Trp165. All transfor- mants were grown on synthetic defined (SD) uracil plates at 30 °C. The colonies on the master plate were replicated on two YPGly plates. These plates were incubated at 30 °C and 37 °C. c, wt and each number indicate control vector [FL67-1423 ⁄ pRS416 (URA3)], wild-type MHR1 [FL67-1423 ⁄ pRS416CM (MHR1, URA3)] and the amino acid number at each mutation site, respectively. All residues listed were replaced with an Ala. DNA-binding sites of Mhr1 T. Masuda et al. 1448 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS Experimental procedures DNA A 74-mer ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japan) and /X174 circular ssDNA (New England BioLabs, MA, USA) were purchased com- mercially. The essDNA was prepared as described in the literature [43–45], with minor modifications, and its concen- tration was determined using an e 260 nm value of 7.0 · 10 3 m )1 Æcm )1 . Expression and purification of Mhr1 For the expression of recombinant Mhr1, E. coli BL21(DE3) pLysS DrecA cells were transformed with the expression vector pET14b–Mhr1 [18]. Cells were grown at 37 °C for 4 h, and recombinant protein expression was induced by the addi- tion of 1 mm isopropyl thio-b-d-galactoside at 18 °C for 16 h. Cells were harvested and suspended in an isotonic solu- tion [25 mm Tris ⁄ HCl (pH 8.0), 50 mm glucose, 5 mm 2-mer- captoethanol, and 0.1 mm p-amidinophenylmethanesulfonyl fluoride hydrochloride]. Cells were disrupted by sonication on ice, and 0.5 m NaCl was then added to the lysate. After centrifugation (45 min at 60 000 g), the supernatant was Putative aromatic-rich loop (163-167: IYWED) N RecA-like domain 1 (N-terminal) RecA-like domain 2 (C-terminal) dnRad54 Mhr1 NTD c CTD HD1 HD2 HD2 77 217 91 619 7371668747934511 6221 Mhr1 (77-217) Aromatic-rich region A B C Fig. 7. Sequence alignment of Mhr1 and dnRad54. (A) Sequence alignment between dnRad54 and Mhr1 using MAFFT alignment software (http://align.bmr.kyushu-u.ac.jp/mafft/software/). Black and gray boxes indicate identity and similarity, respectively. (B) Location of individual domains of dnRad54b and Mhr1. Domains are colored yellow (NTD, N-terminal domain), blue [RecA-like domain (N-terminal)], light blue (HD1, helical domain 1), pink (HD2, helical domain 2), red [RecA-like domain (C-terminal)], and purple (CTD, C-terminal domain). (C) Model structure of the Mhr1 core. Residues 510–649 of dnRad54 were used as a reference structure. The putative aromatic-rich loop (resi- dues 163–167: IYWED) is colored purple. T. Masuda et al. DNA-binding sites of Mhr1 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010 FEBS 1449 [...]... Kurumizaka H, Ikawa S, Nakada M, Eda K, Kagawa W, Takata M, Takeda S, Yokoyama S & Shibata T (2001) Homologous- pairing activity of the human DNA-repair proteins Xrcc3.Rad51C Proc Natl Acad Sci USA 98, 5538–5543 20 Kagawa W, Kurumizaka H, Ikawa S, Yokoyama S & Shibata T (2001) Homologous pairing promoted by the human Rad52 protein J Biol Chem 276, 35201–35208 21 Rybalchenko N, Golub EI, Bi B & Radding CM... Ikeo K & Ogawa T (1993) Cloning of human, mouse and fission yeast recombination genes homologous to RAD51 and recA Nat Genet 4, 239–243 6 Sung P (1994) Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast RAD51 protein Science 265, 1241–1243 7 Baumann P, Benson FE & West SC (1996) Human Rad51 protein promotes ATP-dependent homologous pairing and strand transfer reactions in vitro... structure of Rad54 (Protein Data Bank ID: 1Z3I) was obtained from the Protein Data Bank and was employed as a basal structure A molecular diagram was generated using ucsf chimera [48] Acknowledgements This work was supported in part by Grants-in-Aid from the Japan Society for the Promotion of Science (JSPS) to T Shibata and T Mikawa Funding for the Open Access publication charges for this article was also... superhelical DNA and single-stranded fragments Proc Natl Acad Sci USA 76, 1638–1642 15 Ling F, Makishima F, Morishima N & Shibata T (1995) A nuclear mutation defective in mitochondrial recombination in yeast EMBO J 14, 4090–4101 16 Ling F & Shibata T (2004) Mhr1p-dependent concatemeric mitochondrial DNA formation for generating yeast mitochondrial homoplasmic cells Mol Biol Cell 15, 310–322 DNA-binding sites. .. FEBS T Masuda et al 3 Cox MM & Lehman IR (1981) recA protein of Escherichia coli promotes branch migration, a kinetically distinct phase of DNA strand exchange Proc Natl Acad Sci USA 78, 3433–3437 4 Kahn R, Cunningham RP, DasGupta C & Radding CM (1981) Polarity of heteroduplex formation promoted by Escherichia coli recA protein Proc Natl Acad Sci USA 78, 4786–4790 5 Shinohara A, Ogawa H, Matsuda Y, Ushio... & Lehman IR (1979) Initiation of general recombination catalyzed in vitro by the recA protein of Escherichia coli Proc Natl Acad Sci USA 76, 2615–2619 2 Shibata T, Cunningham RP, DasGupta C & Radding CM (1979) Homologous pairing in genetic recombination: complexes of recA protein and DNA Proc Natl Acad Sci USA 76, 5100–5104 FEBS Journal 277 (2010) 1440–1452 ª 2010 The Authors Journal compilation ª 2010... cerevisiae Dmc1 protein promotes renaturation of single-strand DNA (ssDNA) and assimilation of ssDNA into homologous super-coiled duplex DNA J Biol Chem 276, 41906–41912 13 Li X & Heyer WD (2008) Homologous recombination in DNA repair and DNA damage tolerance Cell Res 18, 99–113 14 Shibata T, DasGupta C, Cunningham RP & Radding CM (1979) Purified Escherichia coli recA protein catalyzes homologous pairing of. .. 566–572 24 Mazloum N, Zhou Q & Holloman WK (2008) D-loop formation by Brh2 protein of Ustilago maydis Proc Natl Acad Sci USA 105, 524–529 25 Ling F, Yoshida M & Shibata T (2009) Heteroduplex joint formation free of net topological change by Mhr1, a mitochondrial recombinase J Biol Chem 284, 9341–9353 26 Masuda T, Ito Y, Terada T, Shibata T & Mikawa T (2009) A non-canonical DNA structure enables homologous. .. electrophoresis, the bands were visualized using the GelStar nucleic acid gel stain (Lonza Group, Switzerland) In vivo complementation assay The yeast strain and the media used were as described previously [15,17,18] The DNA fragment containing the mutation site of Mhr1 was excised from the pET14b–MHR1 plasmid using BmgBI (New England BioLabs) and HindIII (Takara Bio, Shiga, Japan) This fragment was inserted... sites of Mhr1 17 Ling F, Morioka H, Ohtsuka E & Shibata T (2000) A role for MHR1, a gene required for mitochondrial genetic recombination, in the repair of damage spontaneously introduced in yeast mtDNA Nucleic Acids Res 28, 4956–4963 18 Ling F & Shibata T (2002) Recombination-dependent mtDNA partitioning: in vivo role of Mhr1p to promote pairing of homologous DNA EMBO J 21, 4730–4740 19 Kurumizaka H, . promote pairing of homologous DNA. EMBO J 21, 4730–4740. 19 Kurumizaka H, Ikawa S, Nakada M, Eda K, Kagawa W, Takata M, Takeda S, Yokoyama S & Shibata T (2001). Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein Tokiha Masuda 1,2 , Feng Ling 2 , Takehiko