Roles of BNIPXL in regulating cell growth and morphology

... and cell lines 133 3.2.1.2 Expression profile of BNIPXL in murine tissues and cell lines 134 3.2.2 Domain architecture of BNIPXL constructs 140 3.2.3 BNIPXL contains a functional protein-protein ... analyses of the BNIP-2 family 129 3.2 Investigating the biochemical and cellular functions of 133 BNIPXL 3.2.1 Expression profile of BNIPXL 133 3.2.1.1 Expression p...

Ngày tải lên: 16/09/2015, 08:31

... University Results Immunostaining Trip10 is differentially methylated in human cancer cell lines and primary tumor specimens Cells were fixed in 2% formaldehyde in phosphate buffered saline (PBS) and ... Overexpression of Trip10 in IMR-32 cells caused Trip10 and huntingtin to colocalize and form perinuclear foci In contrast, while overexpression of Trip10 in...

Ngày tải lên: 10/08/2014, 05:21

... be involved in recognition of the methylated Lys4 amino group Multidomain organization of LSD1 and its enzymatic activity in the chromatin context Genes coding for LSD1 ⁄ K -demethylase proteins ... protein–protein and DNA–protein interactions [36] The name of this domain derives from its original identification in the proteins SWI3, Rsc8 and Moira, which are ATP-depen...

Ngày tải lên: 16/03/2014, 02:20

... valuable to distin- Blue-light active flavoproteins guish the protonation state of flavin semiquinones by means of the signal width of its typical inhomogeneously broadened EPR resonance centered ... couplings from protons whose nuclear spins are interacting only very weakly with the unpaired electron spin, e.g protons from the protein backbone within the cofactor binding po...

Ngày tải lên: 16/03/2014, 02:20

... extended regions of intrinsic disorder [64] From mammalian cells to yeast: a homologous system in a unicellular organism All of the initial studies indicating a role for QR in stabilizing transcription ... metabolic stability of a subset of cellular proteins Quinone reductase as regulator of the proteasome A Molecular mechanism of interaction Protection against 20S...

Ngày tải lên: 16/03/2014, 02:20

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGA...

Ngày tải lên: 19/02/2014, 05:20

... participated in the synchronization and RNA-extraction and in the interpretation of the data JG and LDV participated in the design of the experiments DI and WV conceived and supervised the study ... Vannerum et al.: Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), w...

Ngày tải lên: 11/08/2014, 11:21

... alpha nasal epithelial stem or progenitor cells inner dynein arms immunofluorescence intraflagellar transport also Tg737, intraflagellar transport 88 intraflagellar transport protein A intraflagellar ... microorganism stimulation and inflammatory cells disorder, epithelial damage and remodeling occurred in NPs Epithelial repair and damage As the results of genetic pred...

Ngày tải lên: 09/09/2015, 11:29

... gel 2 .1. 2 Recombinant DNA XI-XII XIII 6 10 11 11 12 13 14 15 16 17 17 18 19 20 21 22 23 25 27 28 28 28 29 29 29 II Table of contents 2 .1. 2 .1 Restriction endonuclease digestion of DNA 2 .1. 2. 2 DNA ... analysis of pancreas development 4.3.3 gcga promoter analysis 96 96 10 3 10 8 11 3 11 6 11 6 11 9 12 1 12 1 12 2 12 5 IV Table of...

Ngày tải lên: 12/09/2015, 08:16

... of publications • Tham M, Ramasamy S, Gan H, Ramachandran A, Poonepalli A, Yu YH, Ahmed S Chondroitin sulfate proteoglycan stimulates neural stem cell survival via EGFR signalling pathways Manuscript ... quiescent and only become activated at the start of each hair cycle In addition, they are activated during tissue damage and participate in wound healing (Blanpain...

Ngày tải lên: 12/09/2015, 21:26

... Differential expression of miRNAs during cell cycle phases 67 5.2 Role of miR-210 in cell cycle 69 5.3 Role of miR-193a in cell cycle 73 5.4 Roles of miR-122a, miR-96 and miR-107 in cell cycle 78 ... Over -expression of let-7 in cancer cell lines alters cell cycle progression and reduces cell division, and it has been shown that multiple ge...

Ngày tải lên: 05/10/2015, 22:31

... Differential expression of miRNAs during cell cycle phases 67 5.2 Role of miR-210 in cell cycle 69 5.3 Role of miR-193a in cell cycle 73 5.4 Roles of miR-122a, miR-96 and miR-107 in cell cycle 78 ... Over -expression of let-7 in cancer cell lines alters cell cycle progression and reduces cell division, and it has been shown that multiple ge...

Ngày tải lên: 06/10/2015, 20:35

Ngày tải lên: 22/03/2014, 16:20

... Studying the effect of borax on immune cell proliferation (lymphocyte proliferation) The cultures of human lymphocyte were treated with borax at final concentration of 0.1, 0.15, 0.2, 0.3 and ... carcinogenesis The defect in genetic material and immune cell development involves in human carcinogenesis In this study, we studied about the toxic effects of...

Ngày tải lên: 20/06/2014, 00:20

... Dilemmas in the reliable estimation of the in- vitro cell viability in magnetic nanoparticle engineering: which tests and what protocols? Clare Hoskins1, Lijun Wang*1, Woei Ping Cheng2 and ... either the presence of the MNPs both intracellular and on the membrane of the cells or the nanoparticles themselves interfere with the reagents In...

Ngày tải lên: 20/06/2014, 20:20