Tissue engineering of an osteochondral transplant by using a cell scaffold construct

Tissue engineering of an osteochondral transplant by using a cell scaffold construct

Tissue engineering of an osteochondral transplant by using a cell scaffold construct

... Euros awarded Oral presentation on 4th June 2005, Leuven, Belgium International and Local Conferences and Awards Ho STB, Hutmacher DW Tissue engineering of an osteochondral transplant by using a cell ... which has been evaluated by Catelas et al as a carrier for Transforming Growth Factor Beta (TGF-β1) and it was also advocated by Silverman et al as a possible inje...

Ngày tải lên: 14/09/2015, 14:07

218 441 0
Tài liệu Báo cáo khoa học: Rac upregulates tissue inhibitor of metalloproteinase-1 expression by redox-dependent activation of extracellular signal-regulated kinase signaling pptx

Tài liệu Báo cáo khoa học: Rac upregulates tissue inhibitor of metalloproteinase-1 expression by redox-dependent activation of extracellular signal-regulated kinase signaling pptx

... indeed regulated by Rac signaling Recently, we have demonstrated that sustained activation of Rac by overexpression of the Rac- specific activator, Tiam1, or overexpression of V12 -Rac1 , strongly ... Rac signaling towards TIMP-1 A B Fig Identification of regulatory elements within the human tissue inhibitor of metalloproteinase-1 (TIMP-1) promoter, mediating it...

Ngày tải lên: 19/02/2014, 05:20

16 485 0
Tài liệu Báo cáo khoa học: Guanidinium chloride- and urea-induced unfolding of FprA, a mycobacterium NADPH-ferredoxin reductase Stabilization of an apo-protein by GdmCl docx

Tài liệu Báo cáo khoa học: Guanidinium chloride- and urea-induced unfolding of FprA, a mycobacterium NADPH-ferredoxin reductase Stabilization of an apo-protein by GdmCl docx

... FprA unfolding A Trp Emm Max (nm) temperature For native FprA, a broad sigmoidal transition between 30 and 65 °C having an apparent Tm (mid point of thermal denaturation) of  49 °C and a loss of ... presence of increasing concentrations of GdmCl In (A) circles and squares represent data for native and 0.2 M CaCl2-stabilized FprA, respectively changes in enzy...

Ngày tải lên: 19/02/2014, 16:20

9 437 0
ANALYSIS OF NAMES OF ORGANIC CHEMICAL COMPOUNDS BY USING PARSER COMBINATORS AND THE GENERATIVE LEXICON THEORY doc

ANALYSIS OF NAMES OF ORGANIC CHEMICAL COMPOUNDS BY USING PARSER COMBINATORS AND THE GENERATIVE LEXICON THEORY doc

... lexical ambiguity in the chemical language The semantic and syntactic analysis of the chemical names are guided by the types of the terms which they are composed of That is why the following suitable ... on the following tools: the Generative Lexicon Theory (GLT), the Parser Combinators, the functional language CLEAN and the graphic pack Xymt...

Ngày tải lên: 05/03/2014, 20:20

23 541 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

... salt (Tiron) was from Shanghai Reagent Co Ltd (Shanghai, China) All chemicals were of analytical reagent grade, and double-distilled water was used throughout RAW264.7 cells were from American ... with an argon ion laser Acquired images were analyzed using image-pro plus 4.5 software Materials o-Aminobenzenothiol was purchased from Fluka (Shanghai, China) A stock solution (1 mm)...

Ngày tải lên: 16/03/2014, 11:20

9 401 0
development of an ozone gas sensor using single - walled carbon nanotubes

development of an ozone gas sensor using single - walled carbon nanotubes

... Eriksson, Effect of ozone oxidation on single- walled carbon nanotubes, J Phys Chem B 110 (2006) 7113–7118 J Li, Y Lu, Q Ye, M Cinke, J Han, M Meyyappan, Carbon nanotube sensors for gas and organic vapor ... program of MKE/IITA [2006-S-07 8-0 3, Environmental Sensing and Alerting System with Nano-wire and Nano-tube] and partially supported by the National Research Laboratory...

Ngày tải lên: 19/03/2014, 16:47

5 441 0
báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc

báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc

... this article as: Tanaka et al., A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using ... images In Master's the-sis Industrial Engineering, University of Washington; 1993 Tanaka T, Nara H, Ino S, Ifukube T: Clinical Application o...

Ngày tải lên: 19/06/2014, 08:20

8 539 0
báo cáo hóa học: " A preliminary study of clinical assessment of left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology" pdf

báo cáo hóa học: " A preliminary study of clinical assessment of left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology" pdf

... potential to develop a human performance testing and training environment [23] and also a VR system for training individuals with unilateral spatial neglect to cross streets in a safe and vigilant ... deterioration of visual acuity The HMD system has the advantage of being non-invasive, safe, and one can easily change the size of the visual field Although the standard...

Ngày tải lên: 19/06/2014, 10:20

9 542 0
Báo cáo hóa học: " Research Article An Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density Function" pptx

Báo cáo hóa học: " Research Article An Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density Function" pptx

... this paper, we have suggested a new iterative soft bit error rate estimation for the study of any digital communication system performance This method is based on the use of nonparametric pdf estimation ... consider any point to point system communication over any channel transmission (Gaussian, multipath fading, etc.) with or without channel coding using...

Ngày tải lên: 21/06/2014, 23:20

9 340 0
báo cáo khoa học: " Engineering of an E. coli outer membrane protein FhuA with increased channel diameter" doc

báo cáo khoa học: " Engineering of an E. coli outer membrane protein FhuA with increased channel diameter" doc

... inner channel diameter of E coli outer membrane protein FhuA Δ1-159, by the addition of a further b-sheet A conservative approach was chosen, starting with the addition of only two strands, without ... massive FhuA Δ1-159 engineering (addition of two b-strands) is possible without losing channel functionality In the future, a combination of the developed FhuA v...

Ngày tải lên: 11/08/2014, 00:23

8 329 0
Báo cáo y học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pptx

Báo cáo y học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pptx

... 12(4):273-279 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Acad Manage J 1991, 34(3):555-590 Oranta O, Routasalo P, Hupli M: Barriers to and facilitators ... Star Change agenda and its locale Key people leading change Simplicity and clarity of goals Managerial clinical relations Cooperative inter -organizational networks Figure R...

Ngày tải lên: 11/08/2014, 05:21

19 457 0
báo cáo khoa học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pdf

báo cáo khoa học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pdf

... 12(4):273-279 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Acad Manage J 1991, 34(3):555-590 Oranta O, Routasalo P, Hupli M: Barriers to and facilitators ... negative influence of an X positive influence of a Star Change agenda and its locale Key people leading change Simplicity and clarity of goals Managerial clinical rel...

Ngày tải lên: 11/08/2014, 16:20

19 354 0
báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx

báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx

... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT ... http://www.biomedcentral.com/1471-2229/9/94 100 (1) ATGATACTAACCAAAATAGCCCTAAAGAACAAGAACAAAAAGCATCACCTAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT (1) ATGATACTAACCAAAATAGTCCTAAA...

Ngày tải lên: 12/08/2014, 03:20

11 275 0
báo cáo khoa học: " Genetic relationships among seven sections of genus Arachis studied by using SSR markers" ppt

báo cáo khoa học: " Genetic relationships among seven sections of genus Arachis studied by using SSR markers" ppt

... al.: Genetic relationships among seven sections of genus Arachis studied by using SSR markers BMC Plant Biology 2010 10:15 Submit your next manuscript to BioMed Central and take full advantage of: ... determine genetic relationships among 96 accessions of 36 different species and sections of Arachis by using the SSR markers developed by Cuc and c...

Ngày tải lên: 12/08/2014, 03:21

12 157 0
Improve of produced gas quality by using air   steam in fluidized bed gasifier

Improve of produced gas quality by using air steam in fluidized bed gasifier

... classified depending on the gasifying agent: air, steam, steam oxygen, air steam, , etc[2] 3.1 Air gasification The using of air as a gasifying agent is not complex way, however the produced gas is with ... water -gas shift reaction Equation 14, Table However the excessive increase of steam provided, will be lowered the gas quality [8] 3.3 Steam -air gasification...

Ngày tải lên: 09/09/2015, 10:32

12 223 0
w