Tissue engineering of an osteochondral transplant by using a cell scaffold construct
Tissue engineering of an osteochondral transplant by using a cell scaffold construct
... Euros awarded Oral presentation on 4th June 2005, Leuven, Belgium International and Local Conferences and Awards Ho STB, Hutmacher DW Tissue engineering of an osteochondral transplant by using a cell ... which has been evaluated by Catelas et al as a carrier for Transforming Growth Factor Beta (TGF-β1) and it was also advocated by Silverman et al as a possible injectable tissue engineered cartilage ... biphasic scaffold can also be built as an integrated construct with a transition zone between the phases This was demonstrated in Harley et al’s an integrated bilayer scaffold that was fabricated via...
- 218
- 441
- 0
Tài liệu Báo cáo khoa học: Rac upregulates tissue inhibitor of metalloproteinase-1 expression by redox-dependent activation of extracellular signal-regulated kinase signaling pptx
... indeed regulated by Rac signaling Recently, we have demonstrated that sustained activation of Rac by overexpression of the Rac- specific activator, Tiam1, or overexpression of V12 -Rac1 , strongly ... Rac signaling towards TIMP-1 A B Fig Identification of regulatory elements within the human tissue inhibitor of metalloproteinase-1 (TIMP-1) promoter, mediating its activation by Tiam1 ⁄ Rac signaling ... (ROS) on Tiam1 ⁄ Rac- induced upregulation of tissue inhibitor of metalloproteinase-1 (TIMP-1) (A) Effects of catalase and specific inhibitors of mitogen-activated protein kinase kinase (MEK) 1,2...
- 16
- 485
- 0
Tài liệu Báo cáo khoa học: Guanidinium chloride- and urea-induced unfolding of FprA, a mycobacterium NADPH-ferredoxin reductase Stabilization of an apo-protein by GdmCl docx
... FprA unfolding A Trp Emm Max (nm) temperature For native FprA, a broad sigmoidal transition between 30 and 65 °C having an apparent Tm (mid point of thermal denaturation) of 49 °C and a loss of ... presence of increasing concentrations of GdmCl In (A) circles and squares represent data for native and 0.2 M CaCl2-stabilized FprA, respectively changes in enzymatic activity, FAD and tryptophan fluorescence ... molecule [9] We have carried out a detailed characterization of the structural and functional changes associated with the GdmCl- and urea-induced unfolding of FprA Various optical spectroscopic...
- 9
- 436
- 0
ANALYSIS OF NAMES OF ORGANIC CHEMICAL COMPOUNDS BY USING PARSER COMBINATORS AND THE GENERATIVE LEXICON THEORY doc
... lexical ambiguity in the chemical language The semantic and syntactic analysis of the chemical names are guided by the types of the terms which they are composed of That is why the following suitable ... on the following tools: the Generative Lexicon Theory (GLT), the Parser Combinators, the functional language CLEAN and the graphic pack Xymtex of Latex As shown in section 2.3, the Generative Lexicon ... Chemistry terminology The abilities of analysing and correcting the ambiguities of the inadequate names and of using an optimized extension of Xymtec to represent the pictures of the chemical structures...
- 23
- 541
- 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf
... salt (Tiron) was from Shanghai Reagent Co Ltd (Shanghai, China) All chemicals were of analytical reagent grade, and double-distilled water was used throughout RAW264.7 cells were from American ... with an argon ion laser Acquired images were analyzed using image-pro plus 4.5 software Materials o-Aminobenzenothiol was purchased from Fluka (Shanghai, China) A stock solution (1 mm) of DBZTC ... The Authors Journal compilation ª 2007 FEBS 1729 Selective detection of superoxide anion radicals J J Gao et al A B C D Fig Confocal fluorescence and brightfield images of live RAW264.7 macrophages...
- 9
- 401
- 0
development of an ozone gas sensor using single - walled carbon nanotubes
... Eriksson, Effect of ozone oxidation on single- walled carbon nanotubes, J Phys Chem B 110 (2006) 7113–7118 J Li, Y Lu, Q Ye, M Cinke, J Han, M Meyyappan, Carbon nanotube sensors for gas and organic vapor ... program of MKE/IITA [2006-S-07 8-0 3, Environmental Sensing and Alerting System with Nano-wire and Nano-tube] and partially supported by the National Research Laboratory NRL (R0A-200 7-0 0 0-2 011 1-0 ) ... concentration of ozone and the same period of gas injection and degassing, the change of the sensor response was 11% This change was a little bit more than that of the first cycle At Y Park et al / Sensors...
- 5
- 441
- 0
báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc
... this article as: Tanaka et al., A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using ... images In Master's the-sis Industrial Engineering, University of Washington; 1993 Tanaka T, Nara H, Ino S, Ifukube T: Clinical Application of Head Mounted Display System for Left Unilateral Spatial ... left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology Journal of NeuroEngineering and Rehabilitation 2005, 2:31 Granger CV, Hamilton...
- 8
- 538
- 0
báo cáo hóa học: " A preliminary study of clinical assessment of left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology" pdf
... potential to develop a human performance testing and training environment [23] and also a VR system for training individuals with unilateral spatial neglect to cross streets in a safe and vigilant ... deterioration of visual acuity The HMD system has the advantage of being non-invasive, safe, and one can easily change the size of the visual field Although the standard clinical examinations ... Ino S, Ifukube T: Application of head mounted display system for left unilateral special neglect In 14th International Congress of the World Confederation for Physical Therapy Barcelona, Spain;...
- 9
- 541
- 0
Báo cáo hóa học: " Research Article An Iterative Soft Bit Error Rate Estimation of Any Digital Communication Systems Using a Nonparametric Probability Density Function" pptx
... this paper, we have suggested a new iterative soft bit error rate estimation for the study of any digital communication system performance This method is based on the use of nonparametric pdf estimation ... consider any point to point system communication over any channel transmission (Gaussian, multipath fading, etc.) with or without channel coding using any transmission techniques (CDMA, MC-CDMA, TDMA, ... random variable X depends on both the type of receiver and the channel model; Gaussian function for a simple additive white Gaussian noise (AWGN) channel, a mixture of Gaussian functions for an...
- 9
- 340
- 0
báo cáo khoa học: " Engineering of an E. coli outer membrane protein FhuA with increased channel diameter" doc
... inner channel diameter of E coli outer membrane protein FhuA Δ1-159, by the addition of a further b-sheet A conservative approach was chosen, starting with the addition of only two strands, without ... massive FhuA Δ1-159 engineering (addition of two b-strands) is possible without losing channel functionality In the future, a combination of the developed FhuA variants with increased channel length ... produced nanocompartments (liposomes without inserted channel protein, liposomes with inserted FhuA Δ1-159 Exp as well as liposomes with inserted FhuA Δ1-159 and the labelled forms of both channel proteins)...
- 8
- 329
- 0
Báo cáo y học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pptx
... 12(4):273-279 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Acad Manage J 1991, 34(3):555-590 Oranta O, Routasalo P, Hupli M: Barriers to and facilitators ... Star Change agenda and its locale Key people leading change Simplicity and clarity of goals Managerial clinical relations Cooperative inter -organizational networks Figure Role model case Role model ... analysis, and drafting of the manuscript All other authors (JR, JR-M, AS, and MC) actively participated in analysis of data, interpretation of data, revision of the manuscript, and support of...
- 19
- 457
- 0
báo cáo khoa học: " Institutionalizing evidence-based practice: an organizational case study using a model of strategic change" pdf
... 12(4):273-279 Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Acad Manage J 1991, 34(3):555-590 Oranta O, Routasalo P, Hupli M: Barriers to and facilitators ... negative influence of an X positive influence of a Star Change agenda and its locale Key people leading change Simplicity and clarity of goals Managerial clinical relations Cooperative inter -organizational ... as a key organizational component in sustainability of organization transformation Our findings suggest that organizational culture is a contextual determinant of EBP institutionalization As...
- 19
- 354
- 0
báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx
... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT ... http://www.biomedcentral.com/1471-2229/9/94 100 (1) ATGATACTAACCAAAATAGCCCTAAAGAACAAGAACAAAAAGCATCACCTAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT (1) ATGATACTAACCAAAATAGTCCTAAAGAACAAGAACAAAAATCATCACCAAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT ... CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA (601) CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA...
- 11
- 275
- 0
báo cáo khoa học: " Genetic relationships among seven sections of genus Arachis studied by using SSR markers" ppt
... al.: Genetic relationships among seven sections of genus Arachis studied by using SSR markers BMC Plant Biology 2010 10:15 Submit your next manuscript to BioMed Central and take full advantage of: ... determine genetic relationships among 96 accessions of 36 different species and sections of Arachis by using the SSR markers developed by Cuc and colleagues [28] from genomic DNA library of cultivated ... total of 96 groundnut accessions, which represent 36 species, and sections of the genus Arachis were Page of 12 selected for evaluation of genetic relationships and assessing the transferability of...
- 12
- 157
- 0
Improve of produced gas quality by using air steam in fluidized bed gasifier
... classified depending on the gasifying agent: air, steam, steam oxygen, air steam, , etc[2] 3.1 Air gasification The using of air as a gasifying agent is not complex way, however the produced gas is with ... water -gas shift reaction Equation 14, Table However the excessive increase of steam provided, will be lowered the gas quality [8] 3.3 Steam -air gasification Using a mixture of steam and air as a gasifying ... the product gas will increase the heating value of the gas [7] In the present work, it have been studied the effect of steam and air gasification in fluidized bed on syngas quality and It has been...
- 12
- 223
- 0
Từ khóa: you create an image object by using the createimage method of the component ceveryday in tuscany seasons of an italian life by frances mayestissue engineering of lymphatic vesselstissue specific conversion of big et 1 by non endothelial cell ece and effect of ece nep inhibitorstissue engineering of the livertissue engineering of bonetissue engineering of organs brain tissues6 tissue engineering of articular cartilage with mechanical preconditioningtissue engineering of musculoskeletal tissuetissue engineering of hpdlf membrane hao scaffold double construct pdfcomparison of the average accuracies of svm classification systems for the prediction of inhibitors substrates of different p450 isoenzymes by using modeling testing sets and independent validation setshow to make an apple id without using a credit card 2013integrating code written by using a dynamic language into a visual c applicationon initial recognition of an item not deriving from a business combination if the carrying amount differs from its tax baseinitial recognition of an asset or liability in a transaction that is not a business combination and affected neither accounting profit nor taxable incomeNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)