Tài liệu Báo cáo khoa học: Rac upregulates tissue inhibitor of metalloproteinase-1 expression by redox-dependent activation of extracellular signal-regulated kinase signaling pptx

Rac upregulates tissue inhibitor of metalloproteinase-1 expression by redox-dependent activation of extracellular signal-regulated kinase signaling Rainer Engers1, Erik Springer1, Verena Kehren1, Tatjana Simic1, David A Young2, Juliane Beier3, Lars-O Klotz3, Ian M Clark2, Helmut Sies3 and Helmut E Gabbert1 Institute of Pathology, Heinrich-Heine-University, Duesseldorf, Germany School of Biological Sciences, University of East Anglia, Norwich, UK Institute of Biochemistry and Molecular Biology I, Heinrich-Heine-University, Duesseldorf, Germany Keywords ERK; invasion; Rac; reactive oxygen species; Tiam1; TIMP Correspondence R Engers, Institute of Pathology, Moorenstr 5, D-40225 Duesseldorf, Germany Fax: +49 211 8118353 Tel: +49 211 8118341 E-mail: engers@med.uni-duesseldorf.de (Received 21 May 2006, revised 16 August 2006, accepted 21 August 2006) doi:10.1111/j.1742-4658.2006.05476.x The Rho-like GTPase Rac regulates distinct actin cytoskeleton changes required for adhesion, migration and invasion of cells Tiam1 specifically activates Rac, and Rac has been shown to affect several signaling pathways in a partly cell-type-specific manner Recently, we demonstrated that Rac activation inhibits Matrigel invasion of human carcinoma cells by transcriptional upregulation of tissue inhibitor of metalloproteinase-1 The purpose of the present study was to identify key mediators of Tiam1 ⁄ Rac-induced tissue inhibitor of metalloproteinase-1 expression Mutational analysis of the human tissue inhibitor of metalloproteinase-1 promoter revealed a major role for a distinct activating protein-1 site at )92 ⁄ )86 and a minor role for an adjacent polyoma enhancer A3 site Moreover, Rac activation induced the generation of reactive oxygen species and subsequent reactive oxygen species-dependent activation of extracellular signal-regulated kinase 1,2 In contrast, c-Jun N-terminal kinase and p38 mitogenactivated protein kinase activities were not affected In line with this, Tiam1 ⁄ Rac-induced tissue inhibitor of metalloproteinase-1 expression as well as Tiam1 ⁄ Rac-induced binding of nuclear extracts to the activating protein-1 site at )92 ⁄ )86 were inhibited by catalase and by specific inhibitors of the extracellular signal-related kinase-1,2 activators, mitogen-activated protein kinase kinase-1 and mitogen-activated protein kinase kinase-2 (PD098059, U0126) In conclusion, Rac-induced transcriptional upregulation of tissue inhibitor of metalloproteinase-1 is mediated by reactive oxygen species-dependent activation of extracellular signal-related kinase-1,2 and by transcription factors of the activating protein-1 family The Rho-like GTPase Rac mediates distinct actin cytoskeleton changes required for cell adhesion, migration and invasion [1–4] In addition, Rac has been implicated in G1 cell cycle progression [5], apoptosis [6], secretion in mast cells [7], malignant transformation [8], and gene expression [9–15] In the search for the biochemical mechanisms underlying these various biological activities of Rac, at least 15 different Rac effector proteins have been identified so far [16–18] Moreover, Rac was shown to regulate c-Jun N-terminal kinase Abbreviations AP-1, activating protein-1; cPLA2, cytosolic phospholipase A2; EMSA, electrophoretic mobility shift assay; ERK, extracellular signal-regulated kinase; FL, full-length; HRE, hypoxia-response element; JNK, c-Jun N-terminal kinase; MEK, mitogen-activated protein kinase kinase; p38 MAPK, p38 mitogen-activated protein kinase; PEA-3 ⁄ ETS-1, polyoma enhancer A3; RCC, renal cell carcinomas; ROS, reactive oxygen species; SDS, sodium dodecylsulfate; STAT, signal transducer and activator of transcription; TIMP, tissue inhibitor of metalloproteinase; UTE-1, upstream TIMP-1 element-1 4754 FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS R Engers et al (JNK) [9], p38 mitogen-activated protein kinase (p38 MAPK) [10], cytosolic phospholipase A2 (cPLA2) [15], serum response factor [11], nuclear factor jB [13], signal transducer and activator of transcription (STAT)-3 [14], and the formation of reactive oxygen species (ROS) in both phagocytic [19] and nonphagocytic cells [15,20] Recent studies also suggest a role for Rac in the activation of extracellular signal-regulated kinase (ERK) [21–23] However, these Rac-induced signaling events seem to be at least in part cell type-dependent For instance, Rac has been shown to activate JNK and p38 MAPK but not the ERKs in Cos and HeLa cells [9,24] In contrast, in both human kidney 293T cells and HepG2 cells, Rac failed to activate JNK [25,26], and in cardiac myocytes, NIH3T3 cells, human kidney fibroblasts and Rat-2 fibroblasts, an active mutant of Rac (V12-Rac1) either cooperated with c-Raf in ERK activation [21,27,28] or activated ERK dose-dependently [22] Although the exact biochemical, functional and cell type-dependent interplay between these molecules and signaling pathways downstream of Rac is still far from being elucidated, it is well established that all of these signaling events may affect gene expression by modulating different transcription factors [16,29–32] So far, however, only little is known about which genes are indeed regulated by Rac signaling Recently, we have demonstrated that sustained activation of Rac by overexpression of the Rac-specific activator, Tiam1, or overexpression of V12-Rac1, strongly induces transcriptional upregulation of tissue inhibitor of metalloproteinase (TIMP)-1 and post-transcriptional upregulation of TIMP-2 in both human colon carcinomas and renal cell carcinomas (RCCs) in vitro, and consequently inhibits Matrigel invasion of these cells [33] TIMP-1 and TIMP-2 belong to a family of four different isoforms Of these, the prototype member of the TIMP family, TIMP-1, is of particular interest, because in addition to its classic role as a broad specific inhibitor of active matrix metalloproteinases and hence of invasion, metastasis and angiogenesis, it also exhibits growth factor-like activities or suppresses apoptosis [34–36] As Rac has also been reported to stimulate cell proliferation [5] and to inhibit apoptosis [6], one might speculate that these effects of Rac are at least in part also mediated by TIMP-1 TIMP-1 expression can be stimulated by a wide variety of agents, such as serum, growth factors, phorbol esters, cytokines, hormones and viruses, and this occurs primarily at the transcriptional level [37–43] The structure of the TIMP-1 promoter has been elucidated in mouse [44], rat [45], and humans [46] The most prominent feature shared by all three species Rac signaling towards TIMP-1 is the proximal ‘noncanonical’ 22 base pair serum response element, comprising an activator protein-1 (AP-1) site at )92 ⁄ )86 (numbers refer to the human TIMP-1 promoter [46]), followed by a STAT site and a polyoma enhancer A3 (PEA-3 ⁄ ETS-1) site The AP-1 site was shown to be necessary for basal and, in most cases, also for induced expression of the TIMP-1 gene, whereas the adjacent PEA-3 ⁄ ETS-1 site seems to play an additional, albeit minor, role [39,41,46–49] In addition, a hypoxia-response element (HRE) has been found at )27 ⁄ )23 in human kidney fibroblasts [50], and an additional regulatory element, designated as upstream TIMP-1 element-1 (UTE-1), has been identified at )63 ⁄ )53 [51] UTE-1 is bound by Runx1a, Runx1b and Runx2 [52], and was reported to be essential for TIMP-1 transcription in Jurkat cells [51] In the present study, we have investigated the signaling events mediating Rac-induced transcriptional upregulation of TIMP-1 We show that activation of Rac induces ROS formation, followed by ERK1,2 activation and AP-1-mediated TIMP-1 promoter activation In contrast, other signaling pathways such as p38 MAPK, JNK and cPLA2 are not likely to be involved Given the well-established roles of (a) AP-1 in regulating the transcription of numerous genes, and (b) of TIMP-1 as an inhibitor of tumor invasion and metastasis as well as a regulator of cell proliferation and apoptosis, this newly identified signaling pathway might play a major role in different Rac-dependent cell biological properties Results Tiam1 ⁄ Rac-induced activation of the human TIMP-1 promoter is mainly mediated by a distinct AP-1-binding site Recently, we have shown by transient cotransfection that C1199-Tiam1 activates the human TIMP-1 promoter in HepG2 cells and that this effect is mediated by Rac [33] To identify the regulatory elements within the TIMP-1 promoter that mediate this effect, we first tested different length variants of the human TIMP-1 promoter To this end, C1199-Tiam1 (in pcDNA1) was cotransfected with the respective TIMP-1 promoter contructs in HepG2 cells (Fig 1) All constructs proved inducible by C1199-Tiam1, but the strongest induction was seen with the basic promoter construct ()102 ⁄ +95) When smaller TIMP-1 promoter constructs such as )80 ⁄ +95 and )73 ⁄ +95 were used, basal activities, which were determined by cotransfection with empty vector, dropped dramatically to levels barely above background, and no obvious inducibility FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS 4755 Rac signaling towards TIMP-1 R Engers et al Fig Activation of different length variants of the human tissue inhibitor of metalloproteinase-1 (TIMP-1) promoter by C1199-Tiam1 In HepG2 cells, different length variants of the human TIMP-1 promoter (in pBLCAT3; numbers refer to the 5¢-end and 3¢-end of the DNA sequence in relation to the transcriptional start point, which was defined as +1) were transiently cotransfected with C1199Tiam1 or empty vector (pcDNA1), respectively C1199-Tiam1induced effects are presented as n-fold activation of the respective TIMP-1 promoter constructs in comparison to the effects of empty vector (control) All length variants of the human TIMP-1 promoter proved to be inducible by C1199-Tiam1, but the strongest induction was seen with the basic promoter construct ()102 ⁄ +95) The observed effects did not result from differences in protein expression upon transfection, as verified by immunoblotting Data shown are means ± standard deviations of an experiment performed in triplicate, and are representative of three independent experiments by C1199-Tiam1 was seen (data not shown) In addition, the shortest TIMP-1 promoter construct ()42 ⁄ +95) was completely inactive (data not shown) As similar results were also obtained when another expression vector for C1199-Tiam1 (pEGFP) was used (data not shown), these results suggest that the regulatory elements mediating Rac-induced TIMP-1 promoter activation are located downstream of position )102 Furthermore, these results suggest that silencer elements exist between )738 and )102 Previous studies have shown that downstream of )102, the human TIMP-1 promoter harbors binding sites for transcription factors, including AP-1, STAT, PEA-3 ⁄ ETS-1, UTE-1, and the promoter-specific protein factor SP-1 Of these, the AP-1 site has been reported to be critical for basal and mostly also for induced transcription [39,41,46–49] Moreover, Logan et al [47] have reported that the AP-1 and PEA3 ⁄ ETS-1 sites and the proteins binding to them interact to enhance transcription from the whole element Therefore, we analyzed the role of these two sites in Tiam1 ⁄ Rac-induced TIMP-1 promoter activation To this end, different luciferase–TIMP-1 promoter constructs (in the context of )105 ⁄ +95) with mutated (i.e inactive) binding sites for AP-1 and ⁄ or PEA-3 ⁄ ETS-1 transcription factors as well as the corresponding 4756 wild-type )102 ⁄ +95 promoter construct (control) were used for cotransfection experiments with empty vector and C1199-Tiam1, respectively (Fig 2A) Thus, selective inactivation of the AP-1 or PEA-3 ⁄ ETS-1 site or inactivation of both sites simultaneously resulted in a marked reduction of basal transcription, as evidenced by cotransfection with empty vector (mock) In comparison with the respective basal promoter activities, C1199-Tiam1-induced TIMP-1 promoter activation was strongly inhibited by selective inactivation of the AP-1 site and completely inhibited by simultaneous inactivation of the AP-1 and PEA-3 ⁄ ETS-1 sites Selective inactivation of the PEA-3 ⁄ ETS-1 site had an additional but weaker inhibitory effect Moreover, deleting 32 bases around the UTE-1 region (within the )102 ⁄ +95 CAT construct) did no affect C1199-Tiam1induced TIMP-1 promoter activation (data not shown), excluding a role for the UTE-1 site These results suggest that the AP-1 site at )92 ⁄ )86 plays a major role in Tiam1 ⁄ Rac-induced TIMP-1 promoter activation, and that the adjacent PEA-3 ⁄ ETS-1 site is of additional, albeit minor, importance The role of AP-1 transcription factors in Tiam1 ⁄ Rac-induced TIMP-1 promoter activation was further supported in human RCC cells by analyzing binding of nuclear extracts of mock-transfected and C1199Tiam1-transfected RCC cells to the AP-1 site at )92 ⁄ )86 of the human TIMP-1 promoter (Fig 2B) in electrophoretic mobility shift assays (EMSAs) Thus, nuclear extracts of C1199-Tiam1-transfected RCC cells bound markedly stronger to the wild-type AP-1 site than nuclear extracts of mock-transfected control cells Binding to the wild-type AP-1 site was specific, as it could be entirely inhibited by competition with the unlabeled wild-type AP-1 oligonucleotide, but hardly inhibited by competition with the unlabeled mutated, and hence inactivated, *AP-1 oligonucleotide Moreover, in contrast to moderate and strong binding of nuclear extracts of mock-transfected and C1199Tiam1-transfected RCC cells, respectively, to the wildtype AP-1 site, only very weak if any binding to the mutated *AP-1 site could be observed Effects of sustained Rac activation on MAPK activities, ROS formation, and activities of Rho and Cdc42 After having shown that Tiam1 ⁄ Rac-induced upregulation of TIMP-1 is mainly mediated by AP-1 transcription factors, we investigated through which signaling pathway Rac induces AP-1-mediated upregulation of TIMP-1 and whether this pathway is cell densitydependent To address the latter question, TIMP-1 FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS R Engers et al Rac signaling towards TIMP-1 A B Fig Identification of regulatory elements within the human tissue inhibitor of metalloproteinase-1 (TIMP-1) promoter, mediating its activation by Tiam1 ⁄ Rac signaling (A) Effects of C1199-Tiam1 on different )102 ⁄ +95 TIMP-1 promoter mutants, as determined by luciferase reporter gene assays In HepG2 cells, C1199-Tiam1 and empty vector (pcDNA1) were transiently cotransfected with different )102 ⁄ +95 TIMP-1 promoter constructs [WT, wild type )102 ⁄ +95; *AP-1, )102 ⁄ +95 with selectively inactivated activating protein-1 (AP-1) site; *PEA-3, )102 ⁄ +95 with selectively inactivated polyoma enhancer A3 (PEA-3 ⁄ ETS-1) site; *AP-1 ⁄ *PEA-3, )102 ⁄ +95 with AP-1 and PEA-3 ⁄ ETS-1 sites both inactivated] and luciferase activity was subsequently determined (left, absolute values (light units); right, relative values showing C1199-Tiam1-induced effects as fold-induction over mock) Selective inactivation of the AP-1 or PEA-3 ⁄ ETS-1 sites or inactivation of both sites simultaneously resulted in a marked reduction of basal transcription, as evidenced by cotransfection with empty vector (mock) In comparison to the respective basal promoter activities, C1199-Tiam1-induced TIMP-1 promoter activation was strongly inhibited by selective inactivation of the AP-1 site and completely inhibited by simultaneous inactivation of the AP-1 and PEA-3 ⁄ ETS-1 sites Selective inactivation of the PEA-3 ⁄ ETS-1 site had an additional but weaker inhibitory effect The observed effects did not result from differences in protein expression upon transfection, as verified by immunoblotting Results are means ± standard deviations of an experiment performed four times and are representative of three independent experiments (B) Binding of nuclear extracts of mock-transfected and C1199-Tiam1-transfected cells to the wild-type activating protein-1 (AP-1) and mutated (*AP-1), and hence inactivated, AP-1 site ()92 ⁄ )86) of the human TIMP-1 promoter, as determined by electrophoretic mobility shift assay (EMSA) After serum starvation for 24 h, nuclear extracts of mock-transfected (M) and C1199-Tiam1-transfected (T) clearCa-28 renal cell carcinoma (RCC) cells were incubated with a labeled 21 base pair double-stranded oligonucleotide, containing the AP-1 or *AP-1 site ()92 ⁄ )86) of the human TIMP-1 promoter, for 30 min, run on a polyacrylamide gel, and analyzed by autoradiography Binding specificity was verified by competition with an excess (10·) of unlabeled AP-1 and *AP-1 oligonucleotides, respectively In a control reaction, labeled oligonucleotides were incubated without nuclear extracts C3H10T1 ⁄ mouse fibroblast cells (10) were used as a positive control Stable overexpression of C1199-Tiam1 resulted in markedly increased AP-1 binding, which could be blocked by competition with the unlabeled AP-1 but not with the unlabeled *AP-1 oligonucleotide Data are from a single experiment ⁄ autoradiograph The order of the lanes has been changed for clarity of presentation Results are representative of three independent experiments secretion was determined by immunoblotting in supernatants of stably transfected RCC cells at different levels of confluency As shown in Fig 3A, stable overexpression of C1199-Tiam1 and V12-Rac1 strongly induced TIMP-1 secretion at both 50% and 100% confluency of cells, suggesting that the pathway medi- ating Tiam1 ⁄ Rac-induced upregulation of TIMP-1 is independent of the cell density So far, Rac has been reported to induce numerous signaling events ⁄ pathways through partly different mechanisms [9–23,27,28] Of these, the JNK, p38 MAPK and ERK1,2 signaling pathways as well as ROS are known to affect gene FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS 4757 Rac signaling towards TIMP-1 R Engers et al Fig Effects of sustained Rac activation on tissue inhibitor of metalloproteinase-1 (TIMP-1) secretion, reactive oxygen species (ROS) formation and the activities of extracellular signal-related kinase (ERK) 1,2, p38 mitogen-activated protein kinase (p38 MAPK), Rho, and Cdc42 in stably transfected renal cell carconoma (RCC) cells (A) Effects of sustained Rac activation on TIMP-1 secretion at different levels of cell confluency Secretion levels of TIMP-1 were determined by immunoblotting from concentrated serum-free supernatants as previously described [33] Expression of C1199-Tiam1 and V12-Rac1 was verified by immunoblotting with Tiam1-specific and myc-epitope-specific antibodies, respectively Results are representative of two independent experiments (B) Effects of sustained Rac activation on the activities of ERK1,2 and p38 MAPK Cells were serum-starved for 24 h and lysed, and kinase activities were determined by immunoblotting and compared with the expression levels of respective total proteins As a positive control for p38 MAPK activation, mock-transfected cells were treated for h with anisomycin (1 lgỈmL)1) Results are representative of at least three independent experiments (C) Effects of sustained Rac activation on ROS formation as determined by measuring oxidation of an H2O2-sensitive probe, 2¢,7¢-dichlorodihydrofluorescein, in C1199-Tiam1-transfected and V12-Rac1-transfected cells, respectively, relative to mock-transfected control cells after 24 h of serum starvation Rac activation led to elevated levels of ROS, and this effect could be blocked by catalase, supporting a role for H2O2 Results are means ± standard deviation of three independent experiments (D) Effects of sustained Rac activation on Rho and Cdc42 activities, as determined by biochemical pull-down assays C1199-Tiam1 activates Rac, but neither C1199-Tiam1 nor V12-Rac1 affect the activities of Rho or Cdc42 Active Rac and active Cdc42 were precipitated with a biotin–CRIB peptide, and active Rho was precipitated with GST-C21 Precipitates were probed with antibodies against Rac1, Cdc42, and Rho, respectively Aliquots of the respective lysates served as controls for analyzing total amounts of Rac, Cdc42, and Rho, respectively Results are representative of three independent experiments transcription at least in part through AP-1 transcription factors Since Tiam1 ⁄ Rac-induced signaling events are at least partly cell type-dependent, we first analyzed which signaling pathways known to affect the transactivation activities of AP-1 transcription factors and known to be potentially activated by Rac were indeed activated upon stable overexpression of C1199Tiam1 or V12-Rac1 in human RCC cells By immunoblotting with antibodies specific for phosphorylated forms of the respective kinases, we demonstrated that sustained Rac activation in human RCC cells resulted in activation of ERK1,2, but had no effect on p38 MAPK activity (Fig 3B) Moreover, in contrast to anisomycin, which served as a positive control, sustained activation of Rac also failed to induce JNK activation in these cells (data not shown) However, Rac activation led to elevated levels of ROS (Fig 3C), as reflected by increased 2¢,7¢-dichlorofluorescein fluorescence, resulting from oxidation of an H2O2-sensitive probe, 2¢,7¢-dichlorodihydrofluorescein ROS formation induced by C1199-Tiam1 and V12-Rac1, respectively, could be blocked by catalase, supporting a role for H2O2 The effect of V12-Rac1 on ROS formation in human RCC cells was less pronounced than the effect of C1199-Tiam1, which is in accordance with previous observations in epithelial cells [53] Because in NIH3T3 and HeLa cells, respectively, some effects of Rac were found to require Rac-induced downregulation of Rho activity [54,55], we also analyzed the effects of C1199-Tiam1 and V12-Rac1 on Rho activity in human RCC cells by biochemical pull-down assays Thus, stable overexpression of C1199-Tiam1 strongly activated Rac, but neither C1199-Tiam1 nor V12-Rac1 affected Rho activity (Fig 3D) This suggests that Rac-induced upregulation of TIMP-1 is neither 4758 mediated by Rho nor requires downregulation of Rho Moreover, C1199-Tiam1 and V12-Rac1 had no effect on Cdc42 activity (Fig 3D) Similar results as found in human RCC cells were obtained when C1199-Tiamtransfected and V12-Rac1-transfected human colon cancer cells (DusCol-1B) were used (data not shown) Together, these results suggested that Rac-induced upregulation of TIMP-1 might be mediated by ERK1,2 rather than by JNK or p38 MAPK signaling, and imply a possible role for ROS Moreover, downregulation of Rho is not likely to be involved Tiam1 ⁄ Rac-induced upregulation of TIMP-1 is reversed by specific inhibitors of ROS and ERK1,2 signaling pathways To analyze the roles of ERK1,2 and ROS in Racinduced upregulation of TIMP-1, we next treated C1199-Tiam1-transfected RCC cells (clearCa-28) with specific inhibitors of these signaling pathways and investigated their effects on TIMP-1 secretion by quantitative TIMP-1 immunoassays Thus, two different specific inhibitors of the direct upstream kinases of ERK1,2 ) mitogen-activated protein kinase kinase (MEK1,2) (PD098059 and U0126) ) as well as catalase attenuated C1199-Tiam1-induced upregulation of TIMP-1 in a dose-dependent manner (Fig 4A), suggesting a role for ERK1,2 and H2O2 In contrast, a specific inhibitor of p38 MAPK (SB203580) had no effect (Fig 4A) The effects of both MEK1,2 inhibitors and catalase cannot simply be explained by toxic effects or effects on growth and apoptosis, as supernatants were calibrated for the respective cell numbers and cells appeared phenotypically normal by phase contrast microscopy Furthermore, dimethylsulfoxide, FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS R Engers et al Rac signaling towards TIMP-1 A B C D which was used as a vehicle for both MEK1,2 and p38 MAPK inhibitors, had no effect on TIMP-1 secretion, as verified in separate control experiments (data not shown) and as indicated by the fact that SB203580 (dissolved in dimethylsulfoxide) failed to reverse the effect of C1199-Tiam1 In addition, the effects of MEK1,2 inhibitors and catalase on C1199Tiam1-induced TIMP-1 secretion in quantitative TIMP-1 immunoassays were verified by immunoblotting (data not shown) Similar results as observed for C1199-Tiam1-transfected RCC cells were also obtained with C1199-Tiam1-transfected human colon carcinoma cells (Fig 4A), indicating that the observed effects are not restricted to a single cell line, but rather are of more general importance The role of JNK in Tiam1 ⁄ Rac-induced upregulation of TIMP-1 was analyzed by CAT reporter gene assays rather than by means of the commonly used JNK inhibitor SP600125, because recent investigations have suggested a lack of specificity for this compound [56,57] Thus, C1199-Tiam1-induced TIMP-1 promoter activation in HepG2 cells could not be inhibited by cotransfection with a dominant negative cDNA of JNK (Fig 4B), although high expression levels were obtained In line with this, overexpression of constitutively active JNK failed to activate the human TIMP-1 promoter (Fig 4B) From these results, we conclude that Tiam1 ⁄ Rac-induced upregulation of TIMP-1 is mediated by ROS and ERK1,2, whereas JNK and p38 MAPK are not likely to be involved FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS 4759 Rac signaling towards TIMP-1 R Engers et al Fig Roles of extracellular signal-related kinase (ERK) 1,2, p38 mitogen-activated protein kinase (p38 MAPK), c-Jun N-terminal kinase (JNK) and reactive oxygen species (ROS) on Tiam1 ⁄ Rac-induced upregulation of tissue inhibitor of metalloproteinase-1 (TIMP-1) (A) Effects of catalase and specific inhibitors of mitogen-activated protein kinase kinase (MEK) 1,2 (PD098059, U0126) and p38 MAPK (SB203580) on Tiam1 ⁄ Rac-induced TIMP-1 secretion in both human renal cell carcinoma (RCC) (clearCa-28) and human colon carcinoma cells (DusCol-1B), as determined by means of TIMP-1-specific immunoassays (PD, PD098059; U, U0126; SB, SB203580; Cat, catalase; hia, heat-inactivated) Results represent mean values and standard deviations of two independent experiments (*P < 0.05 in comparison to C1199-Tiam1) Dimethylsulfoxide which was used as a vehicle for MEK1,2 and p38 MAPK inhibitors, had no effect, as verified in control experiments (data not shown) and as indicated by the fact that SB203580 (dissolved in dimethylsulfoxide) failed to attenuate C1199-Tiam1-induced TIMP-1 secretion (B) No role of JNK in Tiam1 ⁄ Rac-induced TIMP-1 promoter activation as determined by CAT reporter gene assays In Hep-G2 cells, the human )102 ⁄ +95 TIMP-1 promoter–CAT construct was transiently cotransfected with different expression constructs as indicated (ca-JNK, constitutively active JNK; dn-JNK, dominant negative JNK) (upper part) Results are presented as n-fold activation of the TIMP-1 promoter construct in comparison to the effects of empty vectors Ca-JNK failed to activate the TIMP-1 promoter, and dn-JNK failed to inhibit the C1199-Tiam1-induced TIMP-1 promoter This did not result from a lack of protein expression, as verified by immunoblotting (lower part) Data shown are means ± standard deviations of an experiment performed in triplicate, and are representative of three independent experiments Tiam1 ⁄ Rac-induced binding of nuclear extracts to the AP-1 site at )92 ⁄ )86 is reversed by catalase and by specific inhibition of ERK1,2 signaling To further substantiate the role of ROS and of ERK1,2 signaling in Tiam1 ⁄ Rac-induced and AP-1-mediated upregulation of TIMP-1, we investigated whether Tiam1 ⁄ Rac-induced binding of nuclear extracts to the AP-1 site at )92 ⁄ )86 of the human TIMP-1 promoter could be reversed by specific inhibitors of these pathways To this end, C1199-Tiam1-transfected RCC cells were incubated in the absence or presence of the respective inhibitors, and nuclear extracts of these cells were analyzed for binding to the AP-1 site at )92 ⁄ )86 by EMSAs In line with the results shown above, catalase, as well as PD098059 and U0126, inhibited Tiam1 ⁄ Rac-induced binding of nuclear extracts to the AP-1 site (Fig 5) As verified in control experiments, dimethylsulfoxide, which was used as a vehicle, as well as the p38 MAPK inhibitor SB203580, had no effect (data not shown) These results indicate that Tiam1 ⁄ Rac-induced binding of nuclear extracts to the AP-1 site at )92 ⁄ )86 and subsequent TIMP-1 promoter activation are mediated by ROS and by MEK1,2 ⁄ ERK1,2 Tiam1 ⁄ Rac-induced ERK1,2 activation is ROS-dependent Next, we investigated whether stimulation of ROS formation and ERK1,2 signaling by Rac occurred in a linear signaling cascade or via independent mechanisms As shown above, Rac-induced upregulation of TIMP-1 was inhibited by catalase, suggesting a major role for H2O2 in mediating this effect Therefore, we analyzed whether H2O2 affected ERK1,2 activity in mock-transfected clearCa-28 control cells Indeed, incubation with H2O2 (300 lm, 30 min) strongly induced ERK1,2 activation, and this effect was inhib4760 ited by catalase, whereas heat-inactivated catalase failed to so (Fig 6A) Similar effects were observed when mock-transfected human colon carcinoma cells were used (data not shown) In contrast, inhibition of ERK1,2 signaling by PD098059 or U0126 could not reverse Tiam1 ⁄ Racinduced ROS formation at concentrations that inhibited Tiam1 ⁄ Rac-induced upregulation of TIMP-1 (Fig 6B) From this, we conclude that activation of Rac induces both ROS formation and ERK1,2 activation as part of a linear signaling cascade (Rac fi ROS fi MEK1,2 fi ERK1,2) rather than via independent mechanisms Discussion We have recently shown that in addition to promoting E-cadherin-mediated cell–cell adhesion, transcriptional upregulation of TIMP-1 is another mechanism through which Rac may inhibit invasion of epithelial cells [33] In the present study, we provide evidence that Racinduced transcriptional upregulation of TIMP-1 is mediated by a signaling cascade leading from Rac to TIMP-1 transcription via ROS (H2O2) fi MEK1,2 fi ERK1,2 fi AP-1 Several reports have implicated the AP-1 site at )92 ⁄ )86 as essential for basal as well as for induced activity of the TIMP-1 promoter [39,41,46–49], but other inducible elements, including HRE at )27 ⁄ )23 [50] and UTE-1 at )63 ⁄ )53 [51], have also been described By mutational analysis of the human TIMP-1 promoter and CAT ⁄ luciferase reporter gene assays, we demonstrated that Tiam1 ⁄ Rac-induced promoter activation is mainly mediated by the AP-1 site at )92 ⁄ )86 and that the adjacent PEA-3 ⁄ ETS-1 site at )79 ⁄ )74 plays an additional, albeit minor, role This is in line with the observations of Logan et al [47], who have reported that the AP-1 and PEA-3 ⁄ ETS-1 sites and the FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS R Engers et al Rac signaling towards TIMP-1 A B FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS 4761 Rac signaling towards TIMP-1 R Engers et al proteins binding to them may interact to enhance TIMP-1 transcription from the whole element The role of AP-1 in Tiam1 ⁄ Rac-induced TIMP-1 expression was substantiated by EMSAs showing markedly increased binding of nuclear extracts to the AP-1 site at )92 ⁄ )86 upon stable overexpression of C1199Tiam1 This effect proved specific, as it could be entirely blocked by an excess of unlabeled wild-type AP-1 oligonucleotide, whereas an excess of unlabeled mutated, and hence inactivated, AP-1 (*AP-1) oligonucleotide had hardly any effect In line with this, nuclear extracts of C1199-Tiam1-transfected and mock-transfected cells, respectively, exhibited only weak, if any, binding to *AP-1 In contrast to the AP-1 site at )92 ⁄ )86, the UTE-1 site at )63 ⁄ )53 is not likely to be involved Deleting 32 bases around the UTE-1 region did no affect C1199-Tiam1 ⁄ Rac-induced TIMP-1 promoter activation (data not shown), excluding a role for the UTE-1 site Rac has been shown to induce numerous signaling events ⁄ pathways through partly different mechanisms Fig Role of reactive oxygen species (ROS) and extracellular signal-related kinase (ERK) 1,2 in Tiam1 ⁄ Rac-induced activating protein-1 (AP-1) binding of nuclear extracts Mock-transfected and C1199-Tiam1-transfected human renal cell carcinoma (RCC) cells were serum-starved (0.5% fetal bovine serum) for 24 h and subsequently incubated in serum-free medium (Optimem) for another 24 h Catalase (1 mgỈmL)1; 2940 unitsỈmg)1) and specific inhibitors of MEK 1,2 (PD098059, 25 lM; U0126, 10 lM) were applied 90 or 24 h, respectively, prior to cell lysis As a negative control for catalase, cells were treated with heat-inactivated (hia) catalase Binding of nuclear proteins to the regulatory important AP-1-binding site ()92 ⁄ )86) was determined by electrophoretic mobility shift assays (EMSAs) as described Results are representative of at least three independent experiments As verified in control experiments, dimethylsulfoxide, which was used as a vehicle for MEK1,2 inhibitors, had no effect (data not shown) 4762 and in a partly cell type-dependent manner [9– 23,27,28] Of these mechanisms, JNK, p38 MAPK, and ERK1,2, as well as the generation of ROS, are known to affect gene transcription at least in part through AP-1 transcription factors [30,58] In human RCC cells, sustained activation of Rac induced increased ROS formation as well as activation of ERK1,2, whereas no effects on JNK and p38 MAPK activities were observed Moreover, Rac-induced upregulation of TIMP-1 could be reversed by specific inhibitors of MEK1,2 and by catalase, as shown by quantitative TIMP-1-specific immunoassays In contrast, specific inhibition of p38 MAPK and JNK signaling had no effects These results were substantiated by EMSAs showing that Tiam1 ⁄ Rac-induced binding of nuclear proteins to the important regulatory AP-1 site ()92 ⁄ )86) of the human TIMP-1 promoter was markedly blocked by specific inhibitors of the ERK1,2 signaling pathway and by catalase Therefore, our results suggest that Rac-induced and AP-1mediated upregulation of TIMP-1 requires both ROS and ERK1,2, whereas JNK and p38 MAPK are not likely to be involved Moreover, Rac-induced TIMP-1 expression does not require Rac-dependent downregulation of Rho activity, as reported for some effects of Rac in NIH3T3 fibroblasts and HeLa cells [54,55], as neither C1199-Tiam1 nor V12-Rac1 affected Rho activity in human RCC cells In addition, C1199Tiam1 exclusively activated Rac and exhibited no effect on Cdc42 activity, supporting its role as a specific activator of Rac Similar results as observed for human RCC cells were also obtained for human colon carcinoma cells This excludes a cell type-specific effect, and rather suggests that Rac-induced upregulation of TIMP-1 via ROS and ERK1,2 may be a more general mechanism Despite the fact that so far only little is known about the signaling pathways mediating TIMP-1 expression, our results are in line with recent studies showing that a specific inhibitor of the ERK pathway reduced both retinoic acid-induced and basal TIMP-1 production, whereas specific p38 MAPK inhibitors rather enhanced TIMP-1 expression [43] Similarly, specific MEK inhibitors reversed erythropoietin-induced, oncostatin M-induced and 12-O-tetradecanoylphrobol 13-acetate (TPA)-induced TIMP-1 transcriptional activation ⁄ expression [42,59,60], whereas a potent inhibitor of p38 MAPK failed to so [60] In addition, two recent studies suggested a role for ROS in TIMP-1 expression [61,62] However, in neither of these studies was a role for Rac in TIMP-1 expression investigated Rac has been reported to stimulate ROS formation in phagocytic [19] and nonphagocytic [15,20] cells FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS R Engers et al A B Fig Rac-induced extracellular signal-related kinase (ERK) 1,2 activation is reactive oxygen species (ROS)-dependent (A) In mocktransfected renal cell carcinoma (RCC) cells, H2O2 (300 lM, 30 min) induces activation of ERK1,2, which can be inhibited by active, but not by heat-inactivated (hia), catalase (1 mgỈmL)1 each), as shown by immunoblotting Catalase and hia-catalase, respectively, were applied 30 prior to adding H2O2 Results are representative of three independent experiments (B) No effect of PD098059 (PD) and U0126 (U) on C1199-Tiam1-induced ROS formation ROS formation was determined by measuring oxidation of an H2O2-sensitive probe, 2¢,7¢-dichlorodihydrofluorescein, in mock-transfected and C1199-Tiam1-transfected cells (a.u., arbitrary units) The data shown are means ± standard deviations of an experiment performed in triplicate, and are representative of two independent experiments Accordingly, Rac stimulated ROS (e.g H2O2) formation in human RCC and colon cancer cells, and in addition induced upregulation of TIMP-1 Upregulation of TIMP-1 was reversed by catalase, indicating that this effect is mediated by H2O2 The fact that catalase does not penetrate cell membranes and therefore exerts its effects extracellularly might suggest that H2O2-mediated upregulation of TIMP-1 requires inter- Rac signaling towards TIMP-1 cellular communication This, however, is not necessarily the case Since H2O2 easily penetrates cell membranes, extracellular metabolization of H2O2 by catalase will consequently also result in a reduction of intracellular H2O2 concentrations, and thus catalase may also affect intracellular signaling by H2O2 This is supported by the fact that both C1199-Tiam1-induced and V12-Rac1-induced intracellular ROS (e.g H2O2) formation, as determined by 2¢,7¢-dichlorofluorescein fluorescence, was entirely abrogated by catalase (Fig 3B) In addition to its effect on ROS (e.g H2O2) formation, sustained Rac activation also induced activation of ERK1,2 in both human RCC and colon cancer cells In our search for the functional interplay between ROS and ERK1,2 signaling, we demonstrated that Rac-induced ERK activation was mediated by H2O2 (Fig 6A) This is in line with recent studies showing that H2O2 may activate ERK [63–65] Nevertheless, our results are in contrast to other studies, in which overexpression of constitutively active Rac failed to activate ERK1,2 [9,24] In these studies, however, the effects of Rac on ROS formation were not tested, and this might be crucial in terms of Rac-dependent ERK activation As Rac signaling is at least in part cell type-dependent, the observed differences in ERK activation might be explained by cell type-dependent differences in Rac-induced ROS formation In conclusion, our results suggest that Rac-induced transcriptional upregulation of TIMP-1 takes place via the following signaling cascade: Rac fi ROS (H2O2) formation fi ERK1,2 fi AP-1 fi TIMP-1 Given the well-established roles of AP-1 as a regulator of gene transcription and of TIMP-1 as a regulator of cell proliferation, apoptosis, invasion and metastasis, this newly identified signaling pathway might play a major role in different Rac-dependent cell biological processes Experimental procedures Cell lines, stable gene transfection, and cell culture conditions The human clear cell RCC cell line, clearCa-28, and the human colon carcinoma cell line, DusCol-1B, stably transfected by retroviral transduction with either empty vector (pLZRS), an active mutant of Tiam1 (C1199-Tiam1) [53] or myc-epitope-tagged, constitutively active V12-Rac1, have been described previously [33] In the present study, C1199Tiam1, comprising the C-terminal 1199 amino acids, was used instead of full-length (FL)-Tiam1, because this protein is more stable and active than FL-Tiam1 [53,66,67] Stably transfected cell lines were maintained in DMEM supple- FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS 4763 Rac signaling towards TIMP-1 R Engers et al mented with 10% fetal bovine serum (both Sigma, Taufkirchen, Germany) and antibiotics G418 (Sigma) was used as a selection marker for the presence of pLZRS at a concentration of 500 lgỈmL)1 HepG2 cells were obtained from the German Collection of microorganisms and cell cultures (DSMZ, Braunschweig, Germany) and were maintained in RPMI 1640 medium (Sigma) supplemented with 10% fetal bovine serum and antibiotics Murine C3H10T1 ⁄ fibroblasts were cultured in minimal essential medium with Earle’s salt and l-glutamine (Invitrogen, Karlsruhe, Germany) containing 10% fetal bovine serum (Invitrogen) and antibiotics Cells were incubated at 37 °C in an atmosphere of 5% CO2 Reagents and antibodies Specific inhibitors of p38 MAPK (SB203580), as well as specific inhibitors of the ERK1,2 activators, MEK1 and MEK2 (PD098059 and U0126), were purchased from New England Biolabs (Frankfurt am Main, Germany) Anisomycin and bovine liver catalase were obtained from Sigma (Taufkirchen, Germany) Phospho-specific antibodies against p38 MAPK and ERK1,2, as well as antibodies against total p38 MAPK, ERK1,2, JNK1 and Tiam1, were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA) The polyclonal TIMP-1-specific antibody was purchased from Chemicon (Chandler’s Ford, UK) Mycepitope-tagged V12-Rac1 was detected using monoclonal antibody 9E10 taining 1% Triton X-100, 150 mm NaCl, 20 mm Tris ⁄ HCl (pH 7.5), mm EDTA, mm EGTA, mm sodium orthovanadate, 2.5 mm sodium pyrophosphate, mm b-glycerophosphate, mm phenylmethylsulfonyl fluoride, and lgỈmL)1 leupeptin, and subsequently frozen for at least h at )80 °C Cell debris was removed by centrifugation (20 800 g, 20 min, Mikro22R, Hettich, rotor type 1151), and protein concentrations were determined by the Bradford method JNK was immunoprecipitated from equal amounts (200 lg each) of total protein by means of a polyclonal anti-JNK1 antibody (C-17; Santa Cruz Biotechnology) Then, cell lysates were incubated for h on ice with the antibody to JNK1, and immunocomplexes were captured by overnight incubation with protein A agarose beads (Biomol, Hamburg, Germany) at °C and subsequent centrifugation (1000 g, min) After removal of supernatants, JNK activity was determined by incubating protein A agarose–JNK complexes with 50 lL of 10 mm Tris ⁄ HCl buffer (pH 7.5), containing 150 mm NaCl, 10 mm MgCl2, 0.5 mm dithiothreitol, 15 lm ATP, lCi [c-32P]ATP, and mgỈmL)1 glutathione S-transferase (GST)–cJun (1–79; Alexis, Gruenberg, Germany) at 37 °C for 25 The reaction was stopped by adding 50 lL of Laemmli buffer After denaturation at 90 °C, samples were centrifuged and separated by 10% SDS ⁄ PAGE After electrophoresis, gels were stained, fixed and dried JNK activity was determined as phosphorylation of GST–cJun by means of a phosphoimager As a positive control, mocktransfected cells were treated for h with anisomycin (1 lgỈmL)1) Determination of MAPK activity and immunoblotting GTPase activity assays Protein expression of Tiam1 and myc-epitope-tagged V12Rac1 was analyzed by immunoblotting as previously described [33] To analyze expression and ⁄ or phosphorylation levels of other cellular proteins, cells were maintained for 24 h in medium supplemented with 0.5% fetal bovine serum and lysed in 200 lL of Laemmli sample buffer Samples were then sonicated, and proteins were separated by SDS ⁄ PAGE Activation of p38 MAPK and ERK1,2 was determined by immunoblotting with antibodies specific for phosphorylated, activated forms of these kinases To compare phosphorylation levels of proteins with their respective total expression levels, membranes were stripped by incubation in a buffer containing 62.5 mm Tris ⁄ HCl, 2% (w ⁄ v) sodium dodecylsulfate (SDS) and 100 mm b-mercaptoethanol for 30 at 50 °C, blocked, and reincubated with antibodies specific for the respective total proteins For detection, an enhanced chemiluminescence detection system (Amersham, Munich, Germany) was used As a positive control for p38 MAPK activation, mock-transfected cells were treated for h with anisomycin (1 lgỈmL)1) To determine JNK activity, cells were serum-starved (0.5% fetal bovine serum) for 24 h, lysed in a buffer con- GTPase activity assays were essentially performed as described by Sander et al [54], with the exception that instead of GST–PAK-CRIB, a biotinylated peptide corresponding to the CRIB domain of PAK [68], kindly provided by JG Collard (Netherlands Cancer Institute, Amsterdam, The Netherlands), was used to precipitate active Rac and active Cdc42 Briefly, cells were washed and then lysed with a 1% Nonidet P-40 buffer containing lgỈmL)1 CRIB peptide Cell lysates were then incubated with bacterially produced GST-C21, containing the Rho-binding domain of the Rho effector protein Rhotekin [54,69], bound to glutathionecoupled Sepharose beads Active Rho–GST-C21 complexes were precipitated by centrifugation (1000 g, min), and the remaining supernatants were used to precipitate active Rac–CRIB and active Cdc42–CRIB complexes with streptavidin–agarose in a second step The beads and proteins bound to the beads were washed in an excess of lysis buffer and eluted in SDS sample buffer Total lysates and precipitates were analyzed on western blots using antibodies against Rac1, Cdc42, and Rho (all monoclonal antibodies from BD Transduction Laboratories, Heidelberg, Germany) 4764 FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS R Engers et al Oxidation of dichlorodihydrofluorescein Cells were incubated in medium supplemented with 0.5% fetal bovine serum for 24 h and subsequently treated with 100 lm 2¢,7¢-dichlorodihydrofluorescein diacetate (Sigma) for h After being washed twice, cells were collected and lysed by sonication and one brief freeze–thaw cycle Lysates were cleared by brief centrifugation (1000 g, min), and dichlorofluorescein fluorescence was determined from the supernatants on a Perkin-Elmer LS-5 luminometer (excitation at 498 nm, emission at 522 nm) (Perkin-Elmer, RodganJugesheim, Germany) Fluorescence data were normalized ă against supernatant protein concentrations as determined by the Bradford method Catalase (1 mgỈmL)1), specific MEK1,2 inhibitors (25 lm PD098059, 10 lm U0126) or dimethylsulfoxide (0.38%), the latter of which served as control for MEK1,2 inhibitors, were applied to serumstarved cells h prior to adding 2,7-dichlorodihydrofluorescein diacetate Quantitative TIMP-1 immunoassays and TIMP-1 immunoblotting Quantitative TIMP-1 immunoassays were performed as recently described [33] Briefly, cells were incubated for 48 h either in serum-free medium (Optimem) (Gibco, Karlsruhe, Germany) or serum-free medium supplemented with different compounds as indicated This incubation time was required for mock-transfected and C1199-Tiam1-transfected cells to produce measurable amounts of TIMP-1 Supernatants were collected and calibrated with the cell numbers Subsequently, concentrations of secreted TIMP-1 proteins were determined by a commercially available TIMP-1-specific immunoassay kit (Chemicon), according to the manufacturer’s instructions Differences in TIMP-1 secretion were statistically analyzed by t-test To verify some of the results obtained by quantitative immunoassays and to determine whether the effects of C1199-Tiam1 and V12-Rac1 on TIMP-1 secretion are cell density-dependent, TIMP-1 secretion was analyzed by immunoblotting as described [33] Transient transfections, plasmids, and reporter gene assays To identify the regulatory elements within the human TIMP-1 promoter that mediate Tiam1 ⁄ Rac-induced TIMP1 expression, CAT reporter gene assays were performed as described previously [33] Because of the extremely low transient transfection efficiencies (< 1%) of clearCa-28 and DusCol-1B cells, HepG2 cells were used for these experiments [33] Briefly, HepG2 cells were transiently transfected using the FUGENE Reagent (Roche, Mannheim, Germany) Luciferase assays were performed with a highsensitivity luciferase assay Kit (Roche) using a Beckmann Rac signaling towards TIMP-1 scintillation counter (Beckmann, Munich, Germany) Twenty microliters of (diluted) lysate were mixed with 100 lL of reaction buffer, and all samples were measured successively Tiam1 expression constructs were kindly provided by JG Collard (Netherlands Cancer Institute, Amsterdam, The Netherlands), and cloning procedures have been described previously [66,67,70] The human TIMP-1 promoter–CAT constructs )102 ⁄ +95, )738 ⁄ +95 and )1718 ⁄ +95 have been previously described [46] The numbers of these constructs refer to the respective 5¢-ends and 3¢-ends relative to the transcriptional start point, which was defined as +1 In order to study the involvement of transcription factor-binding sites using the highly sensitive luciferase reporter gene assay (see below), the TIMP-1 promoter–CAT constructs )102 ⁄ +95, bearing inactivating point mutations of AP-1 and ⁄ or PEA-3 ⁄ ETS-1 sites, *AP-1, *PEA-3 ⁄ ETS-1 and *AP-1 ⁄ *PEA-3 [46], as well as the intact )102 ⁄ +95 fragment, were subcloned into the pGL3-luciferase vector (Promega, Mannheim, Germany) A TIMP-1 promoter– CAT construct, DUTE-1, lacking 32 base pairs around the UTE-1 site, was generated by PCR (with the upper primer containing a deletion from )66 to )34) from the )102 ⁄ +95 basal promoter construct The constitutively active JNK construct [71], as well as a hemagglutinin (HA)-epitopetagged dominant negative JNK construct [72], were kind gifts of UR Rapp (Wuerzburg, Germany) HA-epitope tagged dominant negative JNK was subcloned as a SalI ⁄ XhoI fragment into the XhoI site of pMT2SM Upon transient transfection of these constructs, protein expression levels were verified by immunoblotting EMSA Prior to EMSAs, cells were serum-starved (0.5% fetal bovine serum) for 24 h To test the role of ERK1,2 and ROS signaling in C1199-Tiam1-induced AP-1 binding, cells were subsequently incubated in either serum-free medium (Optimem) or serum-free medium supplemented with specific inhibitors of the ERK1,2 pathway (PD98059, 25 lm; U0126, 10 lm) or with catalase (1 mgỈmL)1) as indicated For EMSAs, 10 pmol of 21 base pair double-stranded oligonucleotides, containing either the wild-type (TGGGTG GATGAGTAATGCATC) (AP-1) or the mutated, and hence inactivated (TGGGTGGAGGACTAATGCATC), AP-1 (*AP-1) consensus sites ()92 ⁄ )86) of the human TIMP-1 promoter were end-labeled with T4 polynucleotide kinase (New England Biolabs) in the presence of 10 lCi of [c-32P]ATP for h at 37 °C and subsequently purified with a nucleotide removal kit (Qiagen, Hilden, Germany) For binding reactions, lg of nuclear extracts of treated or nontreated mock-transfected and C1199-Tiam1-transfected RCC cells were incubated with 0.4 pmol of the purified AP-1 and *AP-1 oligonucleotides, respectively, and lg of FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS 4765 Rac signaling towards TIMP-1 R Engers et al poly-dIdC in EMSA buffer (20 mm Hepes, pH 7.9, 90 mm KCl, 0.1 mm MgCl2, 0.5 lm EDTA, 6.25 lm dithiothreitol, 6.25% glycerol) for 30 on ice The specificity of binding of nuclear extracts to labeled AP-1 oligonucleotide was verified by competition with nonlabeled wild-type and mutated AP-1 oligonucleotides, respectively, applied in 10-fold excess In a control reaction, the labeled AP-1 oligonucleotide was incubated without nuclear extracts Samples were mixed with loading buffer (25 mm Tris ⁄ HCl, 0.02% bromophenol blue, 4% glycerol), loaded onto a 6% nondenaturating polyacrylamide gel, and separated in 0.5 · TBE (25 mm Tris ⁄ borate, 0.5 mm EDTA, pH 7.8) at 200 V for 2.5 h Gels were dried and exposed to Kodak (Rochester, NY, USA) X-Omats films at )70 °C 10 11 12 13 Acknowledgements We thank S Traenkner and S Khalil for their excellent technical assistance, and M Ringler and M Bellack for preparation of some of the figures This work was supported by the Deutsche Forschungsgemeinschaft (Ga 326 ⁄ 4-1, GA 326 ⁄ 4-3, SFB 503 ⁄ B1) and the Dr Mildred Scheel Stiftung fur Krebsforschung (10-1582-En I) ă 14 15 References Van Aelst L & D’Souza-Schorey C (1997) Rho GTPases and signaling networks Genes Dev 11, 2295–2322 Hall A (1998) Rho GTPases and the actin cytoskeleton Science 279, 509–514 Evers EE, van der Kammen RA, ten Klooster JP & Collard JG (2000) Rho-like GTPases in tumor cell invasion Methods Enzymol 325, 403–415 Evers EE, Zondag GC, Malliri A, Price LS, ten Klooster JP, van der Kammen RA & Collard JG (2000) Rho family proteins in cell adhesion and cell migration Eur J Cancer 36, 1269–1274 Olson MF, Ashworth A & Hall A (1995) An essential role for Rho, Rac, and Cdc42 GTPases in cell cycle progression through G1 Science 269, 1270–1272 Murga C, Zohar M, Teramoto H & Gutkind JS (2002) Rac1 and RhoG promote cell survival by the activation of PI3K and Akt, independently of their ability to stimulate JNK and NF-kappaB Oncogene 21, 207–216 Norman JC, Price LS, Ridley AJ & Koffer A (1996) The small GTP-binding proteins, Rac and Rho, regulate cytoskeletal organization and exocytosis in mast cells by parallel pathways Mol Biol Cell 7, 1429–1442 Qiu RG, Chen J, Kirn D, McCormick F & Symons M (1995) An essential role for Rac in Ras transformation Nature 374, 457–459 Coso OA, Chiariello M, Yu JC, Teramoto H, Crespo P, Xu N, Miki T & Gutkind JS (1995) The small GTP- 4766 16 17 18 19 20 21 22 23 binding proteins Rac1 and Cdc42 regulate the activity of the JNK ⁄ SAPK signaling pathway Cell 81, 1137– 1146 Bagrodia S, Taylor SJ, Creasy CL, Chernoff J & Cerione RA (1995) Identification of a mouse p21Cdc42 ⁄ Rac activated kinase J Biol Chem 270, 22731–22737 (erratum appears in J Biol Chem 271, 1250) Hill CS, Wynne J & Treisman R (1995) The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF Cell 81, 1159–1170 Westwick JK, Lambert QT, Clark GJ, Symons M, Van Aelst L, Der Pestell RG & Der CJ (1997) Rac regulation of transformation, gene expression, and actin organization by multiple, PAK-independent pathways Mol Cell Biol 17, 1324–1335 Perona R, Montaner S, Saniger L, Sanchez PI, Bravo R & Lacal JC (1997) Activation of the nuclear factor-kappaB by Rho, CDC42, and Rac-1 proteins Genes Dev 11, 463–475 Simon AR, Vikis HG, Stewart S, Fanburg BL, Cochran BH & Guan KL (2000) Regulation of STAT3 by direct binding to the Rac1 GTPase Science 290, 144–147 Woo CH, Lee ZW, Kim BC, Ha KS & Kim JH (2000) Involvement of cytosolic phospholipase A2, and the subsequent release of arachidonic acid, in signalling by rac for the generation of intracellular reactive oxygen species in rat-2 fibroblasts Biochem J 348, 525–530 Aspenstrom P (1999) Effectors for the Rho GTPases Curr Opin Cell Biol 11, 95–102 Bishop AL & Hall A (2000) Rho GTPases and their effector proteins Biochem J 348, 241–255 Cotteret S & Chernoff J (2002) The evolutionary history of effectors downstream of Cdc42 and Rac Genome Biol 3, doi:10.1186/gb-2002-3-2-reviews0002 Abo A, Pick E, Hall A, Totty N, Teahan CG & Segal AW (1991) Activation of the NADPH oxidase involves the small GTP-binding protein p21rac1 Nature 353, 668–670 Joneson T & Bar SD (1998) A Rac1 effector site controlling mitogenesis through superoxide production J Biol Chem 273, 17991–17994 Clerk A, Pham FH, Fuller SJ, Sahai E, Aktories K, Marais R, Marshall C & Sugden PH (2001) Regulation of mitogen-activated protein kinases in cardiac myocytes through the small G protein Rac1 Mol Cell Biol 21, 1173–1184 Woo CH, You HJ, Cho SH, Eom YW, Chun JS, Yoo YJ & Kim JH (2002) Leukotriene B(4) stimulates RacERK cascade to generate reactive oxygen species that mediates chemotaxis J Biol Chem 277, 8572–8578 Eblen ST, Slack JK, Weber MJ & Catling AD (2002) Rac-PAK signaling stimulates extracellular signal-regulated kinase (ERK) activation by regulating formation of MEK1–ERK complexes Mol Cell Biol 22, 6023–6033 FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS R Engers et al 24 Minden A, Lin A, Claret FX, Abo A & Karin M (1995) Selective activation of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and Cdc42Hs Cell 81, 1147–1157 25 Teramoto H, Crespo P, Coso OA, Igishi T, Xu N & Gutkind JS (1996) The small GTP-binding protein rho activates c-Jun N-terminal kinases ⁄ stress-activated protein kinases in human kidney 293T cells Evidence for a Pak-independent signaling pathway J Biol Chem 271, 25731–25734 26 Schuringa JJ, Dekker LV, Vellenga E & Kruijer W (2001) Sequential activation of Rac-1, SEK-1 ⁄ MKK-4, and protein kinase Cdelta is required for interleukin-6induced STAT3 Ser-727 phosphorylation and transactivation J Biol Chem 276, 27709–27715 27 Frost JA, Xu S, Hutchison MR, Marcus S & Cobb MH (1996) Actions of Rho family small G proteins and p21activated protein kinases on mitogen-activated protein kinase family members Mol Cell Biol 16, 3707–3713 28 Frost JA, Steen H, Shapiro P, Lewis T, Ahn N, Shaw PE & Cobb MH (1997) Cross-cascade activation of ERKs and ternary complex factors by Rho family proteins EMBO J 16, 6426–6438 29 Gjoerup O, Lukas J, Bartek J & Willumsen BM (1998) Rac and Cdc42 are potent stimulators of E2F-dependent transcription capable of promoting retinoblastoma susceptibility gene product hyperphosphorylation J Biol Chem 273, 18812–18818 30 Dalton TP, Shertzer HG & Puga A (1999) Regulation of gene expression by reactive oxygen Annu Rev Pharmacol Toxicol 39, 67–101 31 Garrington TP & Johnson GL (1999) Organization and regulation of mitogen-activated protein kinase signaling pathways Curr Opin Cell Biol 11, 211–218 32 Mercurio F & Manning AM (1999) Multiple signals converging on NF-kappaB Curr Opin Cell Biol 11, 226–232 33 Engers R, Springer E, Michiels F, Collard JG & Gabbert HE (2001) Rac affects invasion of human renal cell carcinomas by up-regulating tissue inhibitor of metalloproteinases (TIMP)-1 and TIMP-2 expression J Biol Chem 276, 41889–41897 34 Brew K, Dinakarpandian D & Nagase H (2000) Tissue inhibitors of metalloproteinases: evolution, structure and function Biochim Biophys Acta 1477, 267–283 35 Mannello F & Gazzanelli G (2001) Tissue inhibitors of metalloproteinases and programmed cell death: conundrums, controversies and potential implications Apoptosis 6, 479–482 36 Henriet P, Blavier L & Declerck YA (1999) Tissue inhibitors of metalloproteinases (TIMP) in invasion and proliferation APMIS 107, 111–119 37 Edwards DR, Rocheleau H, Sharma RR, Wills AJ, Cowie A, Hassell JA & Heath JK (1992) Involvement of AP1 and PEA3 binding sites in the regulation of Rac signaling towards TIMP-1 38 39 40 41 42 43 44 45 46 47 murine tissue inhibitor of metalloproteinases-1 (TIMP1) transcription Biochim Biophys Acta 1171, 41–55 Ulisse S, Farina AR, Piersanti D, Tiberio A, Cappabianca L, D’Orazi G, Jannini EA, Malykh O, Stetler-Stevenson WG & D’Armiento M (1994) Folliclestimulating hormone increases the expression of tissue inhibitors of metalloproteinases TIMP-1 and TIMP-2 and induces TIMP-1 AP-1 site binding complex(es) in prepubertal rat Sertoli cells Endocrinology 135, 2479– 2487 Uchijima M, Sato H, Fujii M & Seiki M (1994) Tax proteins of human T-cell leukemia virus type and induce expression of the gene encoding erythroid-potentiating activity (tissue inhibitor of metalloproteinases-1, TIMP-1) J Biol Chem 269, 14946–14950 Silacci P, Dayer JM, Desgeorges A, Peter R, Manueddu C & Guerne PA (1998) Interleukin (IL)-6 and its soluble receptor induce TIMP-1 expression in synoviocytes and chondrocytes, and block IL-1-induced collagenolytic activity J Biol Chem 273, 13625–13629 Botelho FM, Edwards DR & Richards CD (1998) Oncostatin M stimulates c-Fos to bind a transcriptionally responsive AP-1 element within the tissue inhibitor of metalloproteinase-1 promoter J Biol Chem 273, 5211–5218 Kadri Z, Petitfrere E, Boudot C, Freyssinier JM, Fichelson S, Mayeux P, Emonard H, Hornebeck W, Haye B & Billat C (2000) Erythropoietin induction of tissue inhibitors of metalloproteinase-1 expression and secretion is mediated by mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways Cell Growth Differ 11, 573–580 Bigg HF, McLeod R, Waters JG, Cawston TE & Clark IM (2000) Mechanisms of induction of human tissue inhibitor of metalloproteinases-1 (TIMP-1) gene expression by all-trans retinoic acid in combination with basic fibroblast growth factor Eur J Biochem 267, 4150–4156 Coulombe B, Ponton A, Daigneault L, Williams BR & Skup D (1988) Presence of transcription regulatory elements within an intron of the virus-inducible murine TIMP gene Mol Cell Biol 8, 3227–3234 Bugno M, Graeve L, Gatsios P, Koj A, Heinrich PC, Travis J & Kordula T (1995) Identification of the interleukin-6 ⁄ oncostatin M response element in the rat tissue inhibitor of metalloproteinases-1 (TIMP-1) promoter Nucleic Acids Res 23, 5041–5047 Clark IM, Rowan AD, Edwards DR, Bech HT, Mann DA, Bahr MJ & Cawston TE (1997) Transcriptional activity of the human tissue inhibitor of metalloproteinases (TIMP-1) gene in fibroblasts involves elements in the promoter, exon and intron Biochem J 324, 611–617 Logan SK, Garabedian MJ, Campbell CE & Werb Z (1996) Synergistic transcriptional activation of the tissue FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS 4767 Rac signaling towards TIMP-1 48 49 50 51 52 53 54 55 56 57 58 59 R Engers et al inhibitor of metalloproteinases-1 promoter via functional interaction of AP-1 and Ets-1 transcription factors J Biol Chem 271, 774–782 Bahr MJ, Vincent KJ, Arthur MJ, Fowler AV, Smart DE, Wright MC, Clark IM, Benyon RC, Iredale JP & Mann DA (1999) Control of the tissue inhibitor of metalloproteinases-1 promoter in culture-activated rat hepatic stellate cells: regulation by activator protein-1 DNA binding proteins Hepatology 29, 839–848 Jaworski J, Biedermann IW, Lapinska J, Szklarczyk A, Figiel I, Konopka D, Nowicka D, Filipkowski RK, Hetman M, Kowalczyk A & Kaczmarek L (1999) Neuronal excitation-driven and AP-1-dependent activation of tissue inhibitor of metalloproteinases-1 gene expression in rodent hippocampus J Biol Chem 274, 28106–28112 Norman JT, Clark IM & Garcia PL (2000) Hypoxia promotes fibrogenesis in human renal fibroblasts Kidney Int 58, 2351–2366 Trim JE, Samra SK, Arthur MJ, Wright MC, McAulay M, Beri R & Mann DA (2000) Upstream tissue inhibitor of metalloproteinases-1 (TIMP-1) element-1, a novel and essential regulatory DNA motif in the human TIMP-1 gene promoter, directly interacts with a 30-kDa nuclear protein J Biol Chem 275, 6657–6663 Bertrand-Philippe M, Ruddell RG, Arthur MJ, Thomas J, Mungalsingh N & Mann DA (2004) Regulation of tissue inhibitor of metalloproteinase gene transcription by RUNX1 and RUNX2 J Biol Chem 279, 24530–24539 Hordijk PL, ten Klooster JP, van der Kammen RA, Michiels F, Oomen LC & Collard JG (1997) Inhibition of invasion of epithelial cells by Tiam1-Rac signaling Science 278, 1464–1466 Sander EE, ten Klooster JP, van Delft S, van der Kammen RA & Collard JG (1999) Rac downregulates Rho activity: reciprocal balance between both GTPases determines cellular morphology and migratory behavior J Cell Biol 147, 1009–1022 Nimnual AS, Taylor LJ & Bar-Sagi D (2003) Redoxdependent downregulation of Rho by Rac Nat Cell Biol 5, 236–241 Jiang G, Dallas-Yang Q, Liu F, Moller DE & Zhang BB (2003) Salicylic acid reverses phorbol 12-myristate13-acetate (PMA)- and tumor necrosis factor alpha (TNFalpha)-induced insulin receptor substrate (IRS1) serine 307 phosphorylation and insulin resistance in human embryonic kidney 293 (HEK293) cells J Biol Chem 278, 180–186 Bertelsen M & Sanfridson A (2005) Inflammatory pathway analysis using a high content screening platform Assay Drug Dev Technol 3, 261–271 Whitmarsh AJ & Davis RJ (1996) Transcription factor AP-1 regulation by mitogen-activated protein kinase signal transduction pathways J Mol Med 74, 589–607 Sohara N, Trojanowska M & Reuben A (2002) Oncostatin M stimulates tissue inhibitor of metallo- 4768 60 61 62 63 64 65 66 67 68 69 proteinase-1 via a MEK-sensitive mechanism in human myofibroblasts J Hepatol 36, 191–199 Sato T, Koike L, Miyata Y, Hirata M, Mimaki Y, Sashida Y, Yano M & Ito A (2002) Inhibition of activator protein-1 binding activity and phosphatidylinositol 3-kinase pathway by nobiletin, a polymethoxy flavonoid, results in augmentation of tissue inhibitor of metalloproteinases-1 production and suppression of production of matrix metalloproteinases-1 and -9 in human fibrosarcoma HT-1080 cells Cancer Res 62, 1025–1029 Delanian S, Martin M, Bravard A, Luccioni C & Lefaix J (2001) Cu ⁄ Zn superoxide dismutase modulates phenotypic changes in cultured fibroblasts from human skin with chronic radiotherapy damage Radiother Oncol 58, 325–331 Yang ZZ & Zou AP (2003) Homocysteine enhances TIMP-1 expression and cell proliferation associated with NADH oxidase in rat mesangial cells Kidney Int 63, 1012–1020 Chung YW, Jeong DW, Won JY, Choi EJ, Choi YH & Kim IY (2002) H2O2-induced AP-1 activation and its effect on p21(WAF1 ⁄ CIP1)-mediated G2 ⁄ M arrest in a p53-deficient human lung cancer cell Biochem Biophys Res Commun 293, 1248–1253 Daou GB & Srivastava AK (2004) Reactive oxygen species mediate endothelin-1-induced activation of ERK1 ⁄ 2, PKB, and Pyk2 signaling, as well as protein synthesis, in vascular smooth muscle cells Free Radic Biol Med 37, 208–215 Kim YK, Bae GU, Kang JK, Park JW, Lee EK, Lee HY, Choi WS, Lee HW & Han JW (2005) Cooperation of H2O2-mediated ERK activation with Smad pathway in TGF-beta1 induction of p21 (WAF1 ⁄ Cip1) Cell Signal 18, 236–243 Michiels F, Stam JC, Hordijk PL, van der Kammen RA, Salinas PC, Feltkamp CA & Collard JG (1997) Regulated membrane localization of Tiam1, mediated by the NH2-terminal pleckstrin homology domain, is required for Rac-dependent membrane ruffling and C-Jun NH2-terminal kinase activation J Cell Biol 137, 387–398 Michiels F, Habets GG, Stam JC, van der Kammen RA & Collard JG (1995) A role for Rac in Tiam1induced membrane ruffling and invasion Nature 375, 338–340 Price LS, Langeslag M, ten Klooster JP, Hordijk PL, Jalink K & Collard JG (2003) Calcium signaling regulates translocation and activation of Rac J Biol Chem 278, 39413–39421 Reid T, Furuyashiki T, Ishizaki T, Watanabe G, Watanabe N, Fujisawa K, Morii N, Madaule P & Narumiya S (1996) Rhotekin, a new putative target for Rho bearing homology to a serine ⁄ threonine kinase, PKN, and rhophilin in the rho-binding domain J Biol Chem 271, 13556–13560 FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS R Engers et al 70 Stam JC, Sander EE, Michiels F, van Leeuwen FN, Kain HE, van der Kammen RA & Collard JG (1997) Targeting of Tiam1 to the plasma membrane requires the cooperative function of the N-terminal pleckstrin homology domain and an adjacent protein interaction domain J Biol Chem 272, 28447–28454 71 Otto IM, Raabe T, Rennefahrt UE, Bork P, Rapp UR & Kerkhoff E (2000) The p150-Spir protein provides a Rac signaling towards TIMP-1 link between c-Jun N-terminal kinase function and actin reorganization Curr Biol 10, 345–348 72 Hoffmeyer A, Grosse-Wilde A, Flory E, Neufeld B, Kunz M, Rapp UR & Ludwig S (1999) Different mitogen-activated protein kinase signaling pathways cooperate to regulate tumor necrosis factor alpha gene expression in T lymphocytes J Biol Chem 274, 4319– 4327 FEBS Journal 273 (2006) 4754–4769 ª 2006 The Authors Journal compilation ª 2006 FEBS 4769 ... indeed regulated by Rac signaling Recently, we have demonstrated that sustained activation of Rac by overexpression of the Rac- specific activator, Tiam1, or overexpression of V12 -Rac1 , strongly... Rac signaling towards TIMP-1 A B Fig Identification of regulatory elements within the human tissue inhibitor of metalloproteinase-1 (TIMP-1) promoter, mediating its activation by Tiam1 ⁄ Rac signaling. .. (ROS) on Tiam1 ⁄ Rac- induced upregulation of tissue inhibitor of metalloproteinase-1 (TIMP-1) (A) Effects of catalase and specific inhibitors of mitogen-activated protein kinase kinase (MEK) 1,2