Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

... mouse, Fugu, and zebrafish 63 -64 3.5 Assembled sequences of irf6 genomic fragments 64 -66 3 .6 The irf6 gene locus on the LG22 in T51 RH panel and in the Ensembl zebrafish version (ZV6) 68 -69 3.7 Whole-mount ... morpholinos 85 3.14 Loss of irf6 function phenotypes 86- 87 3.15 Comparison of expression of molecular markers in irf6 morphants and wildtype 91-92 3...

Ngày tải lên: 14/09/2015, 12:44

... mutants, trunk notochords are present.  This shows that spt mutation can suppress the 35   Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish flh  mutation,  suggesting  that  in the midline,  flh  is  involved  in promoting  ... Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish phosphorylating  TβR­...

Ngày tải lên: 14/09/2015, 18:03

... GTCCACATCAACGGCCGCCGGCTCG AGCCAACAGACACTCCTGTGTTCC CATGCCAGACCCTGATATTATCACC ACCTACACCAATGTCACCTGGAC GTGCCACACCTACTATGACCACAG TCAAGCCTCCAAACCAAGCC TGGCGGTCCATAAATGAGGTG TATGCAGCTTTGGCAATTCCC TTGATCTTTAGCAACTGTATCTG ... TGGTGGAGGCCTGTTCAGAGC CCAAGTTGTGGGCTGTCAACAC CAGAGTCCTCCTGGTGGACATTC ATTACCAAGCGCAACGCTAGGC CATGTGGCCAACATGTGTG TGATTTGGTCAAGGTAGCC CCTTCTACAACACCAAATGATTGCC AGGCCAGGATGTCAACAC...

Ngày tải lên: 12/08/2014, 04:21

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from...

Ngày tải lên: 17/03/2014, 03:20

... organization of the ORF region of the RNase j family genes is shown in Fig 7A In all organisms examined, the region coding for RNase j is interrupted by two introns, with the exception of the sea urchin ... describe the expression profile of the RNase j gene at various developmental stages and in several tissues of the insect C capitata W...

Ngày tải lên: 23/03/2014, 06:20

... pattern with other species 83 4.5.1 Zebrafish twist1 a and twist1 b genes 83 4.5.2 Zebrafish twist2 85 4.5.3 Zebrafish twist3 86 4.6 Shared and unique expression sites of the zebrafish twist genes 86 ... proteins generated by the neighbor-joining method Figure 3.6: Gene structure of twist1 a, twist1 b, twist2 and twist3 Figure 3.7: RT-PCR of zebrafish...

Ngày tải lên: 16/10/2015, 15:38

... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further inves...

Ngày tải lên: 20/02/2014, 02:21

... The histamine releases were measured by an enzyme immunoassay (Immunotech) After subtraction of the spontaneous release of the basophils, the allergeninduced histamine release was calculated as ... self-prepared tomato extract, nLyc e 2, rLyc e 2, horseradish peroxidase, deglycosylated horseradish peroxidase, the glycopeptide MUXF and MUXF conjugated to BSA as well as BSA alone...

Ngày tải lên: 21/02/2014, 00:20

... pattern of expression of a gene [34–39] To evaluate the relevance of the leader intron in cardosin expression, we deleted it from the 5¢-flanking region of the genes (Fig 8) The deletion of the cardosin ... region of the cardosin B gene (from ) 147 bp to + 238 bp) .The 529 bp of the promoter region of the cardosin A gene that is relevant for gene...

Ngày tải lên: 30/03/2014, 09:20

... drafted the manuscript SP and KS participated in the sequence alignment PL and YP participated in the design of the study and performed the data statistical analysis YP conceived of the study in ... only 64% sequence identity with the other HRV-Cs HRV-CU072 coding sequence analysis To investigate the molecular characteristics of the putative new HRV-C...

Ngày tải lên: 11/08/2014, 21:21

... and attachment of pea seeds to the replum in a pod of the def mutant pea The def mutant pea shows a swollen and thick funicle compared to the wild type Arrows indicate the AZ and ALZ in the wild ... growing of the plants, harvested materials, carried out the structural examination and drafted the manuscript YKL participated in designing t...

Ngày tải lên: 12/08/2014, 03:20

... applications and challenges with bifacial solar cells and modules 10 Background 10 2.1.1 Bifacial solar cells and module structures 10 2.1.2 History of bifacial solar cells and modules ... solar cells and modules This thesis focuses on characterisation and standardisation of bifacial solar cells and modules, and on performance evaluatio...

Ngày tải lên: 09/09/2015, 08:13

... et al., 19 99) 10 0! Table 13 : Changes to ID2 protocol for expression and purification of ID2 and ID3 mutants 10 3! Table 14 : ID1 & ID2 constructs and their theoretical biochemical ... al., 19 90, Biggs, et al., 19 92, Christy, et al., 19 91, Riechmann, et al., 19 94, Sun, et al., 19 91) The mammalian family consisted of four members, namely ID1, ID2, ID3 and ID4...

Ngày tải lên: 09/09/2015, 10:20

... cDNA (bp) AA start AA end #AA pI MW (kDa) 4 02 177 24 6 339 21 9 28 8 Construct 24 1 24 134 82 82 113 82 82 134 59 82 113 73 96 7.8 6.1 8.8 9 .2 6.1 8.8 14.9 6.8 9.3 12. 7 8.3 10.8 Full Length HLH24- 82 ... structure of ID2 3) Analyze the structure of ID2 and look at similarities and differences to other HLH-containing proteins including ID3 ! 20 ! 4) Determine differenc...

Ngày tải lên: 09/09/2015, 10:20

... marker (lane M, kDa) N-HLH82-L (gel A, lane 1), HLH24-82-L (gel B, lane 2), HLH24-82-L-Se-Met (gel C, lane 3) ! 38 ! 3. 3 Protein Identification The purified samples were excised from the gel and analyzed ... SILSLQASEF PSELMSNDSK ALCG Match to: Q53H99_HUMAN Score: 17248 Inhibitor of DNA binding variant (Fragment).- Homo sapiens (Human) Found in search of C:\Documents and Set...

Ngày tải lên: 09/09/2015, 10:20