Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 2

the E-proteins, ID1 was shown to positively regulate the cell cycle by inhibition of an E-protein transcribed gene, the cyclin dependent kinase (CDK) inhibitor, p21. Downregulation of p21 caused a cascade of signaling events that ultimately led to the activation of genes required for S phase progression (Prabhu, et al., 1997). In a different experiment, stable transfection of ID2 in U2OS, a human osteosarcoma cell line, resulted in an increase of cells in S phase detected by flow cytometry (Iavarone, et al., 1994). Constitutively expressed ID genes in immortalized fibroblast cells was shown to cause cytoskeletal disorganization and loss of adhesion (Deed, et al., 1993). ID genes had also been shown to immortalize primary mouse fibroblasts when cotransfected with Bcl2 (Norton, et al., 1998) and in particular, ID1 was able to immortalize primary human keratinocytes leading to the activation of telomerase and inhibition of pRb, a known tumour suppressor (Alani, et al., 1999). Best illustrated in breast cancer, overexpression of ID1 caused mammary epithelial cells to invade the basement membrane and had been shown to be highly associated with more aggressive tumours (Desprez, et al., 1998). Constitutive expression of ID1 in a non-invasive breast cancer cell line produced uncontrolled growth and increased invasion (Lin, et al., 2000). In addition, ID1 was shown to be involved in the regulation of steroid-hormone-responsive growth in breast cancer cells, a loss of which led to uncontrolled growth of breast cancer cells. 1.8 Properties and roles of ID2 ! ID2 was first cloned in 1991 and functioned to inhibit bHLH-domain containing transcription factors in a similar capacity as the other IDs (Langlands, et al., 1997, Sun, et al., 1991). Full-length monomeric ID2 has 134 residues and a calculated molecular weight of 15kDa. The HLH domain of ID2 predicted by Pfam centered around residues 24-76. Expression of ID2 was prevalent in early development in ! 17! many different cell types (Biggs, et al., 1992, Sun, et al., 1991) but had been most studied in the developing muscle and nervous systems (Neuman, et al., 1993, Zhu, et al., 1995). Recently, it was also found to be the earliest marker of trophectoderm cell fate in mouse pre-implantation embryos (Guo, et al., 2010). Besides inhibition of bHLH-containing proteins, ID2, unlike ID1 and ID3 had the ability to bind a non-HLH tumour suppressor, the retinoblastoma protein (pRb), a nuclear phosphoprotein that blocked cell cycle progression by complexing with E2F transcription factors (Sidle, et al., 1996). E2F transcription factors acted to transcribe genes involved in the G1-S transition as well as the S phase of the cell cycle. pRb bound E2F proteins to inhibit their function by blocking cell cycle progression. Sequestering of pRb by ID2 therefore promoted cell cycle progression (Iavarone, et al., 1994, Lasorella, et al., 1996, Toma, et al., 2000). Introduction of pRb in pRb-null SAOS2 human osteosarcoma cells showed a reduction in proliferation. When these cells were co-transfected with both pRb and ID2, the proliferative inhibition was mitigated by the binding of ID2 HLH to Rb (Iavarone, et al., 1994). Owing to this property, an increased level of ID2 in some tumour cells was shown to lead to cellular transformation and tumourigenesis (Gabellini, et al., 2006, Perk, et al., 2005). This made ID2 a promising therapeutic target for the treatment of some cancers (Fong, et al., 2004, Gray, et al., 2008). Therefore, biochemical and structural studies would be useful in understanding ID2’s mechanism of action for developing compounds to block the ID2-pRb interaction. Sequence conservation to the other IDs within the HLH domain averaged at 85% identity whilst at the N and C-termini, the identity dropped to an average of 0-40% over 70-80 residues. As the HLH domain was found to be key for dimerization (Pesce, et al., 1993), the high amount of identity suggested that subtle structural differences between ID2 and other IDs as well as the other bHLHs at the dimer interface could ! 18! be responsible for these binding preferences. Extrapolating the ID3 homology model to ID2, it was expected that the predicted homo- and heterodimeric interactions would be very similar. At a sequence level, the modeled ID3 and ID2 homodimers shared conserved hydrogen bonds at Y44, L50, Y72, Q77 as well as core hydrophobic residues M39, L46, L49, M62, I69, I72, L75. At a structural level, the predicted ID-HLH topology was the same as other bHLH-containing proteins so it was expected that they would bind to all bHLH-containing proteins of the same structure. However, studies showed that ID2 did not form heterodimers with all bHLHcontaining proteins; rather, it selectively interacted with the Group A HLH-containing proteins E47 and E12 as well as MYOD1 but not the Group B USF1 (Sun, et al., 1991) nor the bHLH-z structures like MYC and MAX (Figure 4). When ID2 was cloned, the authors wrote that it did not homodimerize well (Sun, et al., 1991). Others reported ID2 homodimer to be insoluble and tending to aggregate, especially at high concentrations (Colombo, et al., 2006). This could be a reason for the sparse structural information on ID2. ! 19! 1.9 Aim and Scope of Project ! From previous studies, it was clear that the bHLH-containing proteins played crucial roles in early development, neurogenesis, myogenesis and cancer. The HLH domain was found to be well conserved throughout evolution with ID2 having an ortholog in Drosophila (emc gene). A special class of HLH-containing proteins, the IDs were especially interesting due to their lack of a basic domain along with their availability in almost all eukaryotic cells. Members of this family have been known to regulate other Group A bHLH-containing proteins such as E47 (TCF3) and MyoD (MYOD1) but very little was known about why they were so specific in their interactions given the structural similarities to each other and to all the different groups of HLH-containing proteins. Compounded with this was the fact that IDs were short-lived proteins, as they functioned to regulate cell fate and were required to disengage once their roles were complete. This caused problems in studying these proteins as they tended to be highly unstable. ID2 was chosen to represent the Group D HLH-containing proteins in order to find a way in which to stabilize the protein enough for expression and crystallization without compromising its functionality. An ID2 structure would provide a means to better understand how this group differed structurally from other HLH-containing proteins as well as to its paralog ID3. Finally, mutations at key residues based on the structural analysis of ID would help to explain differences in binding affinities. Hence, the specific aims of this study were to: 1) Clone, express, purify and crystallize ID2 2) Solve the crystal structure of ID2 3) Analyze the structure of ID2 and look at similarities and differences to other HLH-containing proteins including ID3 ! 20! 4) Determine differences in binding between ID1, ID2 and ID3 to E47, MyoD and MASH1 through electrophoretic mobility shift assays and mutagenesis experiments of specific residues based on the structural analysis ! 21! ! CHAPTER 2: MATERIALS and METHODS 2.1 Cloning ID2 constructs detailed in Table were cloned from full-length cDNA (a gift from Scripps) using Gateway (Invitrogen) cloning technology. Inserts were amplified by PCR using custom attB-containing primers shown in Table and Table 4. PCR products were recombined with entry vector pDONR221 (Invitrogen) to yield an entry clone that was transformed into OneShot competent Escherichia coli (DE3) cells (Invitrogen) and plated on LB agar plates containing 100 µg/ml kanamycin. Single colonies were used to inoculate ml Luria Broth (LB) containing 50 µg/ml kanamycin and allowed to grow shaking overnight at 37°C. The overnight culture was centrifuged at 720 g in an Eppendorf 5804R with A-4-44 swing-bucket rotor and the pellet used for plasmid isolation using QiaPrep Spin Plasmid Miniprep Kit. The entry clone was subsequently subcloned via the Gateway LR reaction (Invitrogen) according to the manufacturer’s protocols into several expression vectors containing sequences for different affinity and solubility tags namely, pDest-17 (His6), pETG20A (His6-TrxA), pDest-565 (His6-GST), pDest-HisMBP (His6-MBP), pETG-60A (His6-NusA). The expression clones were transformed into BL21 (DE3) Competent E. coli cells (Invitrogen) and plated on LB agar plates containing 100 µg/ml Ampicillin. Single colonies were isolated and grown in ml LB + 100 µg/ml Ampicillin and allowed to grow overnight at 37°C, shaking. The same protocol used to isolate the entry clones was used for the expression plasmids. Inserts were confirmed by sequencing (1st base, http://www.base-asia.com). In addition, ml glycerol stocks of the expression clones were stored (1 ml 70% glycerol + ml overnight culture) at 80°C for future use. ! 22! Table 2: ID2 constructs and their theoretical biochemical properties estimated by ProtParam (Wilkins, et al., 1999). Constructs described in detail (yellow highlight) Construct cDNA (bp) AA start AA end #AA pI MW (kDa) 402 177 246 339 219 288 24 1 24 134 82 82 113 82 82 134 59 82 113 73 96 7.8 6.1 8.8 9.2 6.1 8.8 14.9 6.8 9.3 12.7 8.3 10.8 Full Length HLH24-82 N-HLH82 N-HLH113 HLH24-82-L N-HLH82-L Extinction Coefficient (M-1 cm-1) 4595 4470 4470 4470 4470 4470 Table 3: Primer base for BP cloning (Invitrogen) to create the entry clone for Gateway LR reaction (Invitrogen). attB sites (italics), sequence transferred into pDonr vector during BP reaction (bold), protease sites (underlined). Final selected protease is highlighted in yellow. Primer Type Forward 5’ Forward 5’ Forward 5’ Reverse 3’ Protease Site Prescission TEV Thrombin All Primer base sequence GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTGG AAGTGCTGTTTCAGGGCCCG GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAA ACCTGTATTTTCAGGGC GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTGG TGCCGCGTGGCAGC ggggaccactttgtacaagaaagctgggttTTA Table 4: Sequences for each construct were added to the primer base in Table to complete the primer sequences used for BP cloning. Construct Full Length HLH24-82 N-HLH82 N-HLH113 HLH24-82-L N-HLH82-L ! Forward 5’ ATGAAAGCCTTCAGTCCCGT GAGG CGGAGCAAAACCCCTGTGG ACGAC ATGAAAGCCTTCAGTCCCGT GAGG ATGAAAGCCTTCAGTCCCGT GAGG CGGAGCAAAACCCCTGTGG ACGAC ATGAAAGCCTTCAGTCCCGT GAGG Reverse 3’ TCAGCCACACAGTGCTTTGC TGTC ATGCGAGTCCAGGGCGATCT GCA ATGCGAGTCCAGGGCGATCT GCA ACAGGATGCTGATATCCGTG TTGAG GATGCGAGTCCAGGGCGATC TGCA GATGCGAGTCCAGGGCGATC TGCA 23! 2.2 Site directed mutagenesis Site-directed mutagenesis (QuickChange Kit, Stratagene) was performed as per manufacturer’s instructions. ID2 helix-1 single mutants Y37D, D41G, D41H, K47R and the double mutant Y37D_D41H were created using specific primers. The same was done for ID2 helix-2 mutants Y71A, Y71F, Q76A, Q76D and double mutant Y71A_Q76A. Mutants to interrogate the loop region of ID2 were Q55A, Q55R, K61A, K61Q and the double mutant Q55A_K61A. The equivalent ID3 loop mutants were R60A, R60Q, Q66A and Q66K. Primers are listed in Table and were ordered as HPLC grade to ensure purity for the increased success of the mutagenesis experiment. Table 5: Mutagenesis primers. Mutation shown after first underscore and changed residue denoted by red bold letter. Forward and reverse primers denoted by _F and _R respectively. Changed nucleotide (s) denoted by grey highlight. Hydrogen-bond mutants (helix-2) Residue 66-76 ID2_Y71A_F ID2_Y71A_R Residue 71-81 ID2_Q76A_F ID2_Q76A_R Residue 68-79 ID2_Y71A_Q76A_F ID2_Y71A_Q76A_R Residue 71-81 ID2_Q76D_F ID2_Q76D_R Residue 65-75 ID2_Y71F_F ID2_Y71F_R Q CAG CTG Y TAC CGA V GTC CAG Y TAC CAG L CTG CAG H CAC CAG I ATC GTC I ATC GGC I ATC CGA Q CAG GTC V GTC GTC L TTG CAG D GAC GAT L TTG GTC H CAC CAA I ATC CAA D GAC GGC A GCC CGC D GAC CAG V GTC GAT D GAC GAT L CTG GAT I ATC CAG L CTG GGC I ATC GAA A GCC GGC A GCG CGC L TTG GTC D GAT GAT D GAC GTC I ATC GTC I ATC CAG D GAC CAA I ATC ATC F TTC GAT L TTG GAT A GCC GTC L CTG GAT A GCC CAG I ATC GAC D GAC GAC L CTG CAA A GCG GGC L CTG GTC L TTG GTG L CTG GTG D GAC GAT I ATC GTC D GAC CAA D GAC CTG Q CAG CTG S TCG GTA A L GCC CTG GAT GAC S TCG GAT L CTG CAG ! ! ! ! ! ! ! ! ! ! ! ! ! ! 24! ! ! Table 5: Mutagenesis primers (continued from above) N-terminal helix-1 binding specificity mutants Residue 32-43 ID2_Y37D_F ID2_Y37D_R Residue 35-47 ID2_D41G_F ID2_D41G_R Residue 35-47 ID2_D41H_F ID2_D41H_R Residue 42-52 ID2_K47R_F ID2_K47R_R Residue 35-47 ID2_Y37D_D41G_F ID2_Y37D_D41G_R Residue 35-47 ID2_Y37D_D41H_F ID2_Y37D_D41H_R -P--M--S--L--L--D--N--M--N--D--C--YCCGATGAGCCTGCTAGACAACATGAACGACTGCTAC GTAGCAGTCGTTCATGTTGTCTAGCAGGCTCATCGG -L--L--Y--N--M--N--G--C--Y--S--K--L--KCTGCTATACAACATGAACGGCTGCTACTCCAAGCTCAAG CTTGAGCTTGGAGTAGCAGCCGTTCATGTTGTATAGCAG -L--L--Y--N--M--N--H--C--Y--S--K--L--KCTGCTATACAACATGAACCACTGCTACTCCAAGCTCAAG CTTGAGCTTGGAGTAGCAGTGGTTCATGTTGTATAGCAG -C--Y--S--K--L--R--E--L--V--P--STGCTACTCCAAGCTCAGGGAGCTGGTGCCCAGC GCTGGGCACCAGCTCCCTGAGCTTGGAGTAGCA -L--L--D--N--M--N--G--C--Y--S--K--L--KCTGCTAGACAACATGAACGGCTGCTACTCCAAGCTCAAG CTTGAGCTTGGAGTAGCAGCCGTTCATGTTGTCTAGCAG -L--L--D--N--M--N--H--C--Y--S--K--L--KCTGCTAGACAACATGAACCACTGCTACTCCAAGCTCAAG CTTGAGCTTGGAGTAGCAGTGGTTCATGTTGTCTAGCAG Residue 50-60 ID2_Q55A_F ID2_Q55A_R Residue 50-60 ID2_Q55R _F ID2_Q55R _R Residue 56-66 ID2_K61A_F ID2_K61A_R Residue 56-66 ID2_K61Q_F ID2_K61Q_R Residue 52-64 ID2_Q55A_K61A_F ID2_Q55A_K61A_R -V--P--S--I--P--Q--N--K--K--V--SGTGCCCAGCATCCCCGCGAACAAGAAGGTGAGC GCTCACCTTCTTGTTCGCGGGGATGCTGGGCAC -V--P--S--I--P--Q--N--K--K--V--SGTGCCCAGCATCCCCCGGAACAAGAAGGTGAGC GCTCACCTTCTTGTTCCGGGGGATGCTGGGCAC -N--K--K--V--S--K--M--E--I--L--QAACAAGAAGGTGAGCGCGATGGAAATCCTGCAG CTGCAGGATTTCCATCGCGCTCACCTTCTTGTT -N--K--K--V--S--K--M--E--I--L--QAACAAGAAGGTGAGCCAGATGGAAATCCTGCAG CTGCAGGATTTCCATCTGGCTCACCTTCTTGTT -S--I--P--Q--N--K--K--V--S--K--M--E--IAGCATCCCCGCGAACAAGAAGGTGAGCGCGATGGAAATC GATTTCCATCGCGCTCACCTTCTTGTTCGCGGGGATGCT Residue 55-65 ID3_R60A_F ID3_R60A_R Residue 55-65 ID3_R60Q_F ID3_R60Q_R Residue 61-71 ID3_Q66A_F ID3_Q66A_R Residue 61-71 ID3_Q66K_F ID3_Q66K_R -V--P--G--V--P--A--G--T--Q--L--SGTACCCGGAGTCCCGGCAGGCACTCAGCTTAGC GCTAAGCTGAGTGCCTGCCGGGACTCCGGGTAC -V--P--G--V--P--Q--G--T--Q--L--SGTACCCGGAGTCCCGCAAGGCACTCAGCTTAGC GCTAAGCTGAGTGCCTTGCGGGACTCCGGGTAC -G--T--Q--L--S--A--V--E--I--L--QGGCACTCAGCTTAGCGCGGTGGAAATCCTACAG CTGTAGGATTTCCACCGCGCTAAGCTGAGTGCC -G--T--Q--L--S--K--V--E--I--L--QGGCACTCAGCTTAGCAAGGTGGAAATCCTACAG CTGTAGGATTTCCACCTTGCTAAGCTGAGTGCC ID2 loop region mutants ID3 loop region mutants ! ! 25! 2.3 Protein expression optimization To test for protein expression and solubility of the different expression clones, factors known to affect protein expression were varied. Experiments were performed in ml small-scale experiments. Variable factors included media (Luria Broth (LB) and Terrific Broth (TB)), induction temperatures and times (17°C for 18 hrs, 25°C for hrs, 30°C for hrs), IPTG concentrations (0.2 mM – mM) and solubility tags. Glycerol stock scrapes were used to inoculate ml LB overnight at 37°C. 2% overnight inoculums were added to ml fresh LB or TB and grown shaking at 37°C till an OD600 of 0.6 was reached. 500 µl samples were taken before induction, pelleted down for 10 at 15,700 g in an Eppendorf 5415R mini-centrifuge with F45-24-11 rotor at 4°C, and stored at -20°C for sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Each tube was then induced with varying concentrations of Isopropyl-β-D-thio-galactoside (IPTG) and grown at each of the temperatures mentioned previously. At the end of the induction times, the cultures were centrifuged at 4,225 g for 10 at 4°C in a Sorvall SLA-3000 rotor and the supernatant discarded. Pellets were resuspended in 500 µl lysis buffer (50 mM Tris-HCL pH 8.0, 300 mM NaCl), transferred to a 1.5 ml eppendorf tube and sonicated on ice for 10s at 35% amplitude (1s on, 1s off). The sonicate was centrifuged for 10min at 15,700 g in an Eppendorf 5415R mini-centrifuge with F4524-11 rotor at 4°C and samples of the supernatant and pellet together with the uninduced sample were evaluated by SDS-PAGE on 12% SDS-Tris-Glycine gels run at 200V for 40 min. 2.4 Native protein expression Glycerol stock scrapes of HLH24-82-L and N-HLH82-L pDest-565/TEV constructs were grown overnight in 200 ml LB at 37°C. 10 ml overnight inoculums were cultured in 5L of LB containing 100 µg/ml Ampicillin separated equally into 10 2L flasks in a ! 26! shaker/incubator at 37°C until an OD600 of 0.7 was reached. The cultures were induced with 0.2 mM IPTG and allowed to grow at 17°C for 18 h while shaking. 2.5 Seleno-Methionine (Se-Met) substituted protein expression HLH24-82-L pDest-565/TEV glycerol stock was plated on Ampicillin selective agar overnight at 37°C. A single colony was picked and grown in ml LB+100 µg/ml Ampicillin at 37°C overnight in a shaker incubator. The culture was centrifuged at 720 g in an Eppendorf 5804R with A-4-44 swing-bucket rotor for min. The pellet was resuspended in ml M9 (12.8 g/L Na2HPO4-7H2O, 3.1 g/L KH2PO4, 0.5 g/L NaCl, 0.5 g/L MgSO4, 0.1 mM CaCl2, g/L NH4Cl, 20% d-Glucose) minimal media and centrifuged again at 720 g in an Eppendorf 5804R with A-4-44 swing-bucket rotor for min. The pellet was resuspended in ml M9 media and added to 150 ml M9 media and allowed to grow overnight at 37°C in a shaker incubator. 5ml of overnight culture was added to fresh M9 media in a ratio of 1:100 till OD600 reached 0.6 at 37°C (~6hrs). Amino acid mix containing 100 mg K, F, and T; 50 mg I, L, and V, and 60 mg Se-Met per liter was added and mixed for 10 at 37°C. The culture was induced with 0.4mM IPTG and allowed to grow at 18°C for 18 hours. 2.6 Cell Harvesting Cells were harvested by ultracentrifugation in Nalgene plastic 50 ml tubes at 11,952 g in a Sorvall SS-34 rotor for 10 at 4°C. The pellets were resuspended in cold lysis buffer (50 mM Tris-HCL pH 8.0, 300 mM NaCl, 30 mM Imidazole) and ultrasonicated for at 30% amplitude pulsed for s on, s off on ice. The supernatant was filtered through a 0.22 µm membrane after ultracentrifugation for h at 36,603 g in a Sorvall SS-34 rotor, 4°C to remove any cell debris in preparation for purification. Buffer contained mM DTT for Se-Met protein. ! 27! 2.7 Protein Purification Protein purification was performed on the Akta Express (GE Healthcare) system at 4°C. The first step involved affinity chromatography using nickel beads (5 ml HisTrap FF columns from GE Healthcare) equilibrated in lysis buffer to capture all His6tagged fusion proteins from crude lysate. The peak elutions (buffer: 50 mM Tris-HCL pH 8.0, 300 mM NaCl, 300 mM Imidazole) were immediately desalted in 50 mM TrisHCL pH8.0, 100 mM NaCl buffer using a Hiprep 26/10 desalting column (GE Healthcare). The protein solution was mixed in a TEV protease to protein ratio of 1:100 at 4°C overnight. ml Resource S (GE Healthcare) ion-exchange chromatography was performed in an increasing salt gradient up to 1M NaCl on the cleaved protein mixture to separate the fusion tag from the protein. To remove residual tag, the eluted protein fractions were pooled and run on a slow gradient through a ml HisTrap HP (GE Healthcare) and the unbound fractions were collected, pooled and buffer exchanged (50 mM Tris-HCL pH 8.0, 100 mM NaCl) while being concentrated using a membrane-based concentrator with a 3000 Da MW cutoff (Vivaspin, Sartorius). All buffers contained 5mM DTT for the Se-Met protein to prevent selenium oxidation that could cause problems with detecting a signal for Se with X-rayed. The Bradford (Quickstart, BioRad) assay was used to quantitate protein concentration as per manufacturer’s instructions. 20 µl aliquots of HLH24-82-L (11 mg/ml), N-HLH82-L (7 mg/ml) and HLH24-82-L-Se-Met (7.5 mg/ml) at 90% purity and higher were stored at -80°C. 2.8 Electrophoretic mobility shift assay Electrophoretic mobility shift assays (EMSA) were performed in triplicate and as described previously (Hara, et al., 1997) with minor modifications. The EMSAs used protein from N-HLH82-L construct as this had the highest resolution dataset. Single stranded forward and reverse 5’-Cy5-labelled probes for e-box-containing ! 28! (underlined) MCK promoter sequence 5’-GGATCCCCCCAACACCTGCTGCCTGA and mutant e-box probe 5’-GGATCCCCCCAAACTGGTCTGCCTGA (Sigma, Proligo) with their exact reverse complements were annealed in a BioRad thermal cycler. Purified E47 (residues 545-606) was used alone and in combination with ID2-N-HLH after serial dilution and incubated for 10 at room temperature in binding buffer (20 mM Tris-HCL pH 8.0, 50 mM KCl, mM DTT, mM EDTA, 10% glycerol, 0.1 mg ml-1 BSA). μM Cy5-labelled probe was added for an additional 15 at room temperature to a final reaction volume of 20 μL. Samples were electrophoresed on a 6% Tris-glycine native polyacrylamide gel in 1xTris-glycine (25 mM Tris pH 8.3, 192 mM Glycine) buffer at 4°C for 130 at 300 V and imaged using a Typhoon phosphor-imager (Amersham Biosciences). 2.9 Crystallization Initial screens were done by an automated robot liquid-dispenser (Innovadyne) in a 96-well format via sitting-drop vapour diffusion by combining 200 nl protein with 200 nl precipitant solution equilibrated over a 50 μl reservoir of precipitant. Screening kits from Qiagen and Hampton Research were used and the best crystals were found in Qiagen’s Cation Suite for all constructs after 4-5 days at 18°C. Hits were found in conditions 4.5M Ammonium Acetate (grid ID: E8) for HLH24-82-L-Se-Met, 0.1 M MES pH 6.5, 2.0 M Potassium Acetate (grid ID: G8) for N-HLH82-L and 0.1 M MES pH 6.5, 2.5 M Lithium Acetate (grid ID: C9) for HLH24-82-L. Conditions were optimized manually by hanging drop vapor diffusion using μl of protein solution mixed with μl precipitant solution and allowed to grow at room temperature, 18°C and 4°C. Optimal manual setup temperature was found to be 18°C at the same conditions as the screens except for the Se-Met protein which could only be replicated with 3M Ammonium Acetate. Crystals started to form on Day and maximized growth was usually around Day 7. Crystals were cryo-looped and flash ! 29! cooled in liquid nitrogen prior to data collection. Microseeding was required for HLH24-82-L construct. A seed stock was created by using a drop of crystals crushed in 60 μl of mother liquor and centrifuged for 10 mins at 15,700 g in an Eppendorf 5415R mini-centrifuge with F45-24-11 rotor. Serial dilutions of 1:10, 1:100, 1:1000, 1:10,000 were prepared from the seed stock. Hanging drops were setup for each dilution by using μl diluted stock solution, μl mother liquor and μl protein solution. 2.10 X-ray data collection and processing Crystals from the optimized manual screens were tested for diffraction on a PLATINUM 135 CCD detector with focused X-ray source Cu Kα radiation from an X8 PROTEUM rotating-anode generator (Bruker AXS) controlled by PROTEUM2 software (Sheldrick, 2008). Native and MAD datasets were collected at Argonne National Laboratory synchrotron, GM/CA-CAT, Sector 23, beam line ID-D equipped with a MAR300 CCD detector for HLH24-82-L and HLH24-82-L-Se-Met crystals respectively. MAD dataset was collected at Peak (12,658.3 eV), Inflection (12,656.5 eV) and Remote (13,058.3 eV) energies. Native datasets for crystals of N-HLH82-L were collected at Brookhaven National Laboratory synchrotron on the X29 beamline equipped with ADSC Q315r detector at wavelength 1.08090 Å. All datasets were collected under standard cryogenic conditions (-173°C). Both native datasets were integrated, indexed, merged and scaled with HKL2000 (Miller-Hance, et al., 1991) software. Although a MAD dataset was collected for HLH24-82-L-Se-Met, only the Peak energy data was used; indexed and integrated in MOSFLM (Miller, et al., 1991) and scaled with SCALA (CCP4 suite) (Evans, 2006). Details of expression and purification protocols for the mutants can be found in the Appendix. ! 30! CHAPTER 3: RESULTS and DISCUSSION (Expression to X-ray Data Collection) 3.1 Cloning and Small-scale Protein Expression The motivation behind the different ID2 constructs was based on reports that ID2 did not homodimerize well (Sun, et al., 1991) and that the homodimer was known to be insoluble and to aggregate at high concentrations (Colombo, et al., 2006). Many published in vitro experiments used ID proteins that retained solubility tags or were made at low concentrations for biochemical studies. The challenge was to express enough soluble ID2 that was stable at high concentrations in order to conduct crystallization trials. To alleviate the instability issues, constructs (Table 2) were created based on the published properties of ID2. Combined domain prediction sites pFam (protein family database) (Finn, et al., 2010) and The Simple Modular Architecture Research Tool (SMART) (Schultz, et al., 1998) predicted that the HLH region ranged from residues 28-81 (Table 6). Previous experiments found that the HLH domain alone was enough for dimerization (Ellenberger, et al., 1994, Ma, et al., 1994) but additional residues surrounding it were required for stability (Liu, et al., 2000). Beyond the HLH region, the sequence diverged except for small pockets of similarity. An example was the canonical D-box (destruction box) motif (RxxLxxxN) located C-terminal of the HLH at residues 100-107 in ID2 and conserved in ID1 and ID4 (Lasorella, et al., 2006). This motif was shown to be a target for APC (anaphase promoting complex) to bind, hence signaling the protein for degradation (Lasorella, et al., 2006). In addition, mutation of the D-box increased the half-life of ID2 10-fold without compromising its ability to dimerize (Meng, et al., 2009). ! ! 31! Table 6: Domain prediction results for ID2 from Ensembl release 67 Domain Database Superfamily Prosite_profiles Smart Pfam AA Start 38 28 37 AA End 108 76 81 76 Description HLH_DNA-bd HLH_DNA-bd HLH_DNA-bd Ascession SSF47459 PS50888 SM00353 PF00010 To avoid degradation via the D-box and increase stability but include minimally the HLH and some surrounding residues, a construct was created to start at residue 24 and end at residue 82 (HLH24-82) (Table 2). Additionally, the full-length protein, as well as a construct including the D-box (N-HLH113) were made based on Superfamily (Reinke, et al., 1991) domain prediction (Table 6) to see how they performed in comparison. As expected, results of the small-scale expression studies showed that the full-length and N-HLH113 constructs either did not produce any soluble protein or were completely absent even with different solubility tags, induction temperatures and media (Figure 6). ! 32! Figure 6: Representative small-scale protein expression tests. SDS-PAGE on 12% gels: Insoluble (P) and soluble (S) fractions were alternated with 30°C and 17°C induction temperatures. Each gel denotes a different expression vector (labeled at the bottom of gel). All experiments used LB media and were induced with 0.2 mM IPTG. The order of the samples was the same for all gels apart from the positions of the marker. Red boxes denote where expected bands should be. (A) before induction (lane U), marker (lane M), full-length insoluble (lane P) at 30°C, full-length soluble (lane S) at 30°C, full-length insoluble (lane P) at 17°C, full-length soluble (lane S) at 17°C, HLH24-82-L insoluble (lane P) at 30°C, HLH24-82-L soluble (lane S) at 30°C, HLH24-82-L insoluble (lane P) at 17°C, HLH24-82-L soluble (lane S) at 17°C, N-HLH113 insoluble (lane P) at 30°C, NHLH113 soluble (lane S) at 30°C, N-HLH113 insoluble (lane P) at 17°C, N-HLH113 soluble (lane S) at 17°C. Expressed only in insoluble fraction for His6 tag (B) Expressed only in insoluble fraction for His6-Trx tag (C) Expressed only in insoluble fraction for His6-MBP tag (D) Red arrow shows soluble fraction of ID2 (HLH24-82-L) induced at 17°C for His6-GST tag (E) No expression with His6-NusA tag ! 33! However, HLH24-82 inserted in vector pDest-565 (His6-GST) induced at 17°C showed some expression in the soluble fraction (Figure 6D, red arrow). This was used for downstream large-scale expression and purification described in the next section. To confirm that the insert was that of ID2, HLH24-82 (pDest-565) was analyzed by sequencing (1st Base). Sequencing results pointed to an error in the reverse primer used in the BP cloning step (Table 4, last rows). Instead of a stop codon after residue 82, an additional nucleotide (Table 4, bold and underlined) caused a frameshift that introduced a short polypeptide (LKPSFLVQSGDIAS) at the C-terminus. Therefore, the construct was renamed as HLH24-82-L to denote the additional C-terminal polypeptide. To correct the error, new primers (Table 4, rows 2-3) were used to repeat all the cloning and expression steps for HLH24-82. As before, the pDest-565 construct produced soluble protein. However, once the tag was removed, the protein immediately precipitated. Changes to the pH of the buffer, the buffer itself, as well as the experimental temperature did not improve the insolubility issues. Since previous reports suggested a need for additional residues to stabilize the HLH domain, a new construct containing the full N-terminus up to residue 82 was made (N-HLH82). However, that still did not solve the insolubility issue post tag removal. In parallel, the protein containing the C-terminal polypeptide, HLH24-82-L, was used in large-scale protein expression (Section 3.2) and was successful. The purified protein showed no signs of aggregation and looked unchanged for a week at room temperature (Figure 7). To test if the polypeptide aided in the protein’s stability, the erroneous primer was used to create N-HLH82-L that used residues 1-82 of ID2 as the base and introduced the C-terminal polypeptide. Small-scale expression of this protein proved to be completely stable after solubility tag cleavage so the two constructs containing the C- ! 34! terminal polypeptide stabilizer were subsequently used for large-scale protein expression and purification. Figure 7: Stability of HLH24-82-L containing polypeptide stabilizer over days at room temperature (25°C). SDS-PAGE 12% gel: marker (lane M), Day (lane 1), Day (lane 2), Day (lane 3), Day (lane 4) 3.2 Protein Expression and Purification Optimal expression conditions were found using Luria broth induced with 0.2 mM IPTG for 18 h at 17°C with the expression vector pDest-565 containing an N-terminal His6-GST-TEV tag that included each of inserts HLH24-82-L and N-HLH82-L. HLH24-82-L was used in a seleno-methionine replacement experiment for anomalous dispersion. Typical yields ranged between 1.5 – mg of pure ID2 per litre of bacterial culture. The chromatography profiles of all constructs were virtually identical so a representative set of profiles is shown in Figure (A, C, E). The affinity chromatography profile utilizing the His6 tag to trap the fusion ID2 protein was performed and immediately desalted (Figure 8A). All fractions were pooled (Figure B, lane 3; G, lane 2; J, lane 3) and the tag cleaved off with TEV (Figure B, lane 4; G, lane 3; J, lane 4). The resulting mixture was used as the starting material for ion exchange chromatography (Figure 8C) to remove the tag from the protein of interest ! 35! [...]... temperature (25 °C) SDS-PAGE 12% gel: marker (lane M), Day 0 (lane 1), Day 1 (lane 2) , Day 3 (lane 3), Day 6 (lane 4) 3 .2 Protein Expression and Purification Optimal expression conditions were found using Luria broth induced with 0 .2 mM IPTG for 18 h at 17°C with the expression vector pDest-565 containing an N-terminal His6-GST-TEV tag that included each of inserts HLH24- 82- L and N-HLH 82- L HLH24- 82- L was... positions of the marker Red boxes denote where expected bands should be (A) before induction (lane U), marker (lane M), full-length insoluble (lane P) at 30°C, full-length soluble (lane S) at 30°C, full-length insoluble (lane P) at 17°C, full-length soluble (lane S) at 17°C, HLH24- 82- L insoluble (lane P) at 30°C, HLH24- 82- L soluble (lane S) at 30°C, HLH24- 82- L insoluble (lane P) at 17°C, HLH24- 82- L soluble... collected under standard cryogenic conditions (-173°C) Both native datasets were integrated, indexed, merged and scaled with HKL2000 (Miller-Hance, et al., 1991) software Although a MAD dataset was collected for HLH24- 82- L-Se-Met, only the Peak energy data was used; indexed and integrated in MOSFLM (Miller, et al., 1991) and scaled with SCALA (CCP4 suite) (Evans, 20 06) Details of expression and purification... 720 g in an Eppendorf 5804R with A-4-44 swing-bucket rotor for 5 min The pellet was resuspended in 5 ml M9 ( 12. 8 g/L Na2HPO4-7H2O, 3.1 g/L KH2PO4, 0.5 g/L NaCl, 0.5 g/L MgSO4, 0.1 mM CaCl2, 5 g/L NH4Cl, 20 % d-Glucose) minimal media and centrifuged again at 720 g in an Eppendorf 5804R with A-4-44 swing-bucket rotor for 5 min The pellet was resuspended in 2 ml M9 media and added to 150 ml M9 media and. .. (Quickstart, BioRad) assay was used to quantitate protein concentration as per manufacturer’s instructions 20 µl aliquots of HLH24- 82- L (11 mg/ml), N-HLH 82- L (7 mg/ml) and HLH24- 82- L-Se-Met (7.5 mg/ml) at 90% purity and higher were stored at -80°C 2. 8 Electrophoretic mobility shift assay Electrophoretic mobility shift assays (EMSA) were performed in triplicate and as described previously (Hara, et al.,... mutants can be found in the Appendix ! 30! CHAPTER 3: RESULTS and DISCUSSION (Expression to X-ray Data Collection) 3.1 Cloning and Small-scale Protein Expression The motivation behind the different ID2 constructs was based on reports that ID2 did not homodimerize well (Sun, et al., 1991) and that the homodimer was known to be insoluble and to aggregate at high concentrations (Colombo, et al., 20 06) Many... ID2 from Ensembl release 67 Domain Database Superfamily Prosite_profiles Smart Pfam AA Start 38 8 28 37 AA End 108 76 81 76 Description HLH _DNA- bd HLH _DNA- bd HLH _DNA- bd Ascession SSF47459 PS50888 SM00353 PF00010 To avoid degradation via the D-box and increase stability but include minimally the HLH and some surrounding residues, a construct was created to start at residue 24 and end at residue 82 (HLH24- 82) ... Laboratory synchrotron, GM/CA-CAT, Sector 23 , beam line ID-D equipped with a MAR300 CCD detector for HLH24- 82- L and HLH24- 82- L-Se-Met crystals respectively MAD dataset was collected at Peak ( 12, 658.3 eV), Inflection ( 12, 656.5 eV) and Remote (13,058.3 eV) energies Native datasets for crystals of N-HLH 82- L were collected at Brookhaven National Laboratory synchrotron on the X29 beamline equipped with ADSC Q315r... Qiagen and Hampton Research were used and the best crystals were found in Qiagen’s Cation Suite for all constructs after 4-5 days at 18°C Hits were found in conditions 4.5M Ammonium Acetate (grid ID: E8) for HLH24- 82- L-Se-Met, 0.1 M MES pH 6.5, 2. 0 M Potassium Acetate (grid ID: G8) for N-HLH 82- L and 0.1 M MES pH 6.5, 2. 5 M Lithium Acetate (grid ID: C9) for HLH24- 82- L Conditions were optimized manually... replacement experiment for anomalous dispersion Typical yields ranged between 1.5 – 2 mg of pure ID2 per litre of bacterial culture The chromatography profiles of all 3 constructs were virtually identical so a representative set of profiles is shown in Figure 8 (A, C, E) The affinity chromatography profile utilizing the His6 tag to trap the fusion ID2 protein was performed and immediately desalted (Figure . structure of ID2 3) Analyze the structure of ID2 and look at similarities and differences to other HLH-containing proteins including ID3 ! 21 ! 4) Determine differences in binding between ID1, ID2 and. MyoD and MASH1 through electrophoretic mobility shift assays and mutagenesis experiments of specific residues based on the structural analysis ! 22 ! CHAPTER 2: MATERIALS and METHODS ! 2. 1. 6.1 6.8 4470 N-HLH 82 24 6 1 82 82 8.8 9.3 4470 N-HLH113 339 1 113 113 9 .2 12. 7 4470 HLH24- 82- L 21 9 24 82 73 6.1 8.3 4470 N-HLH 82- L 28 8 1 82 96 8.8 10.8 4470