Molecular analysis of the breeding biology of the asian arowana (scleropages formosus)
Molecular analysis of the breeding biology of the asian arowana (scleropages formosus)
... attainable size, big and long fins of the RG1 and the intense colouration of the MG One of the shortfalls of the hybrid is the large variation of phenotypes produced in their offsprings which is common ... particularly the subfamily Osteoglossinae We hope that our work will enhance the understanding of the evolution of the breeding biology of teleost, a...
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf
... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were per...
báo cáo hóa học:" Molecular analysis of the apoptotic effects of BPA in acute myeloid leukemia cells" potx
... loading Results BPA induces dose dependent apoptosis in acute myeloid leukemia cells To understand the potential role of BPA in biological systems of leukemias we tested the action of BPA in three ... activity of these compounds [17,18] In the present manuscript, we decided to investigate the effects of different doses of BPA on acute myeloid l...
Báo cáo y học: " Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia" potx
... al.: Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia Virology Journal 2010 7:302 Submit your next manuscript to BioMed Central and take full advantage of: ... NH and OB conceived of the study, participated in its design, and in drafting the manuscript HT and JB participated in the study design and coor...
Molecular analysis of the roles of yeast microtubule associated genes in agrobacterium mediated transformation
... and Schroer, 2000) There are two types of kinesin, kinesin-1 and kinesin-2 Kinesin-1 is found to be involved in the transport of various organelles including Golgi complex (Lippincottschwartz et ... structure of the host genome, thus facilitating the inserting of T-DNA 1.4 The response of the host cells to Agrobacterium infection Similar to other pathogens, Agrobacter...
Molecular analysis of the p14 ARF hdm2 p53 regulatory pathway in breast carcinoma
... representation of the cell cycle, showing the role of p53 at the G1/S checkpoint Figure 10 Schematic representation of the p1 4ARF- hdm2- p53 regulatory pathway The binding of p53 to hdm2 results in inactivation ... 1.5.2 The role of p53 at the G1/S checkpoint of the cell cycle 22 1.5.3 Inactivation of p53 23 1.5.4 Significance of p53 in...
Molecular analysis of the gene LAS17 mediating t DNA trafficking inside yeast cells
... adapter to bring the VirE2 to the importin Once inside the nucleus, VIP2 may target the T- DNA to areas of chromatin that are being actively transcribed, so that the T- DNA can integrate into the ... The natural host of A tumefaciens is the plant cell The formation, transfer and Integration of the T- DNA into the plant cell requires three genetic compone...
Molecular analysis of the role of a yeast potassium transport component TRK1 in agrobacterium mediated transformation
... Trk1- Seq-F1 ACAAAGACAGCACCAACAGA Trk1- Seq-R1 GAAGTAGTGAACCGCGATAA Trk1- Seq-F2 TGGATCGTGCAATTATCTTG Trk1- Seq-R2 AAGGCGATTAAGTTGGGTAA 26 2.2 DNA manipulation 2.2.1 Transformation of plasmid DNA ... seelection marrker 25 Table 2.5: List of primers Primer Sequence (5’-3’) GFP1 GATAAGGCAGATTGAGTGGA GFP2 AAAGATGACGGTAACTACAA TO105-2F CTAGGGATCCGCCACCATGCATTTTAGAAGAACGAT TO105-2R CTAGG...
Molecular analysis of maternal diabetes induced changes in the developing neural tube
... in e A III LV E B dc dc e vtw vtw E C vt dt D Fig Thickness of Ventral Telencephalon Wall (µm) 300 250 * 200 150 100 50 Fig Control Diabetic vt dt vt vt A B Fig % of BrdU-cells in Ventral ... vt B e A Fold of induction 3.5 ** 2.5 1.5 0.5 Control Diabetic B 333bp C Fig dc dc III vt A vt B LV A Fig dc e dc III vt vt LV A Fig dt B III e e e dc vt LV A Fig 10 B A Fold of induction 1.5...
Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx
... hypoxanthineguanine phosphoribosyltransferase (hprt) locus of lymphocytes isolated from spleens of mice following exposure to ozone, NNK, and DBP, and combined treatments of NNK and DBP on ozone for 32- ... Molecular analysis of hprt mutation 383 Table DNA sequence analysis of hprt mutant in splenic cells of B6C3F1 male mice in 52- wk study Typ...
LIVE TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM MEDIATED TRANSFORMATION
... LIVE- TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM- MEDIATED TRANSFORMATION LI XIAOYANG (B Sc Science.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Comparison of transient transformation, stable transformation and VirE2 delivery in AMT of yeast 67 IX LIST OF FIGURES Figure 3.1 Possible roles of...
Molecular analysis of genes mediating t DNA trafficking inside yeast cells
... Agrobacterium is to successfully and stably transfect of plant tissue post TDNA translocation it is important that, the T- DNA be protected from nuclease activity, the T- DNA be transported to the nucleus ... attachment motif similar to that of vitronectin (Swart et al 1994) This glycoprotein is thought to be involved in the first direct attachment of the bacteria to plant cells...
Molecular analysis of mutations in agrobacterium tumefaciens under selection pressure 1
... 1. 1 Overview of the regulation of point mutation and insertion mutation in bacteria 1. 1 .1. Regulation of point mutation in bacteria 1. 1 .1. 1 Proof reading 1. 1 .1. 2 ... 1. 1 .1. 2 Mismatch repair 1. 1 .1. 3 Oxidative DNA damage 1. 1 .1. 4 Other regulators 11 1. 1.2 Regulation of transposition in bacteria 12 1. 1.2 .1 Mechanism of ... 13 1. 1.2.2 Intrinsic...