Functional characterization of giant killer in flower development and meristem regulation in arabidopsis thaliana 1
... ………………………………….4 1. 3 Regulation of flower development in Arabidopsis thaliana ……………………….9 1. 4 Patterning and differentiation of lateral organs in Arabidopsis thaliana 13 1. 4 .1 The patterning of lateral ... Results…………………………………………………………………………… 11 6 5.2 .1 Protein sequence alignment for GIK1 and GIK2.…………………… 11 6 5.2.2 Expression of GIK2 in inflorescence...
Ngày tải lên: 14/09/2015, 08:46
... reported to be involved in the regulation of flowering and hypocotyl elongation (Xiao et al., 20 09) Overexpression of AHL 22 effectively delays the flowering process in Arabidopsis In spite of these ... transforms the inflorescence meristem into a terminal flower Figure 1: Inflorescence meristem and floral meristem in Arabidopsis thaliana Upper panel: sche...
Ngày tải lên: 14/09/2015, 08:46
... and R52 participates in the binding of Tat to TAR and is involved in the nuclear localisation of Tat [18,19] The strong or total suppression of transactivation abilities observed in many of the ... selection of multiple nonsynonymous mutations in tat in a unique epidemiologically-linked cohort following transmission of HIV-1 Comparisons of the...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot
... and R52 participates in the binding of Tat to TAR and is involved in the nuclear localisation of Tat [18,19] The strong or total suppression of transactivation abilities observed in many of the ... selection of multiple nonsynonymous mutations in tat in a unique epidemiologically-linked cohort following transmission of HIV-1 Comparisons of the...
Ngày tải lên: 20/06/2014, 01:20
báo cáo khoa học: "Transcriptome analysis by GeneTrail revealed regulation of functional categories in response to alterations of iron homeostasis in Arabidopsis thaliana" pdf
... article as: Schuler et al.: Transcriptome analysis by GeneTrail revealed regulation of functional categories in response to alterations of iron homeostasis in Arabidopsis thaliana BMC Plant Biology ... incorporated into the GSEA tool of GeneTrail as individually defined categories Contrary to the GeneTrail- predefined categories the genes of MapM...
Ngày tải lên: 11/08/2014, 11:20
báo cáo khoa học: " The development and geometry of shape change in Arabidopsis thaliana cotyledon pavement cells" doc
... view and b’ xy view Insets are projections of the xz and yz views of subregions a’ and b’, respectively *, indicates the location of the adaxial periclinal surface of the cell in the xz and yz ... yz and xz views of subregions c’ and d’, respectively *, indicates the location of the adaxial periclinal surface of the cell in the yz and xz views...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Small chloroplast-targeted DnaJ proteins are involved in optimization of photosynthetic reactions in Arabidopsis thaliana" potx
... to distinguish the individual roles of these DnaJ proteins in co-chaperone/chaperone cohort Nevertheless, in general, these small chloroplast DnaJ proteins participate in optimization of CO2 ... specific band was missing from the respective DnaJ mutant This indicates that chloroplasts are at least one of the compartments containing these small DnaJ proteins...
Ngày tải lên: 12/08/2014, 03:21
Study on the downstream targets of DELLA proteins in arabidopsis thaliana
... for the CBS domain-containing proteins in plants So far, 48 Arabidopsis proteins have been designated as CBS domaincontaining proteins (Ignoul & Eggermont, 2005), which include γ-type subunits of ... helices The CBS domain-containing proteins comprise a large family of evolutionarily conserved proteins that have been found in all kingdoms of life, among which the m...
Ngày tải lên: 11/09/2015, 10:18
báo cáo khoa học: " Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development" ppt
... Page of 15 Figure Expression profiles of Actinidia flowering genes in mature plant organs Real-time RT-PCR analysis of the Actinidia flowering genes in the root, stem internode, leaf, flower and ... Figure Expression profiles of Actinidia flowering genes in normal and aberrant flowers Real-time RT-PCR analysis of the Actinidia flowering genes in the lea...
Ngày tải lên: 11/08/2014, 11:22
Functional characterization of HGF and its receptor c met in zebrafish development
... paracrine signaling in liver development The coexpression of hgfa and c- met in pectoral fin, hgfb and c- met in proneprhic duct also indicate their paracrine signaling in the development of these ... Characterizing HGF and its receptor c- met s role in zebrafish development (Manuscript in preparation) v LIST OF FIGURES Fig.1.1 Schematic represent...
Ngày tải lên: 12/09/2015, 08:18
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Functional characterization of artemin, a ferritin homolog synthesized in Artemia embryos during encystment and diapause doc
... within negatively stained particles of artemin indicated the lack of metal storage capacity Function of an Artemia ferritin homolog A B C Artemin, apoferritin and ferritin inhibit citrate synthase ... denaturation Artemin, apoferritin and ferritin protected citrate synthase against denaturation at 43 °C in a concentrationdependent manner (Fig 3A C) Maximal protec...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: Functional characterization of ecdysone receptor gene switches in mammalian cells docx
... DNA binding domain and VP16 activation domain Various combinations of the EcR ligand binding domain, VP16 activation domain and GAL4 DNA binding domain were constructed (Fig 1A) and tested in NIH ... probably in uence the behavior of fusion protein upon binding to ligand Apparently, having activation domain (VP16) and DNA binding domain (GAL4), in that order, on the NH2-terminal end...
Ngày tải lên: 16/03/2014, 12:20
Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc
... volume and energetic properties of the binding of CO to hemoproteins Biophys J 66, 89–98 Tuckey RC & Kamin H (1983) Kinetics of O2 and CO Binding to adrenal cytochrome P-450scc Effect of cholesterol, ... was in the range of values determined in previous studies for the interaction between bovine Adx and bCYP11B1 Biacore measurements were performed to investigate the bindin...
Ngày tải lên: 30/03/2014, 04:20