Role of p73 in regulation of cell death specific role in mi

Role of p73 in regulation of cell death specific role in mitotic cell death and potential regulation of caspase 2s

... ROLE OF P73 IN REGULATION OF CELL DEATH: SPECIFIC ROLE IN MITOTIC CELL DEATH AND POTENTIAL REGULATION OF CASPASE- 2s TOH WEN HONG NATIONAL UNIVERSITY OF SINGAPORE 2007 ACKNOWLEDGMENT ... Up -regulation of caspase- 2S in Saos2 p73 inducible cell line and Sh5y stably expressing DNp73β 146 Fig 4.10: ChIP of p73 on 22 bp p73 binding site...

Ngày tải lên : 13/09/2015, 21:21

238
205
0

Báo cáo hóa học: "Vehicular connectivity in urban scenarios: effectiveness and potential of roadside, moving WAVE providers and hybrid solutions" doc

... clear indication of the scarce connectivity provided by moving providers only in a urban scenario is also given Therefore, a solution addressing the trade-off between connectivity and easiness of ... connectivity in urban scenarios: effectiveness and potential of roadside, moving WAVE providers and hybrid solutions EURASIP Journal on Wireless Comm...

Ngày tải lên : 20/06/2014, 22:20

10
326
0

Báo cáo hóa học: " Role of protease-activated receptor-2 on cell death and DNA fragmentation in Helicobacter pylori-infected gastric epithelial cells" ppt

... Results Inhibition of PAR-2 expression augments H pyloriinduced cell death and DNA fragmentation in gastric epithelial cells To investigate the relations of PAR-2 expression, cell death, and DNA fragmentation, ... gastric epithelial cells, determined by cell death and DNA fragmentation Inhibition of PAR-2 expression suppresses H pyloriinduced activa...

Ngày tải lên : 18/06/2014, 16:20

7
399
0

báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pptx

... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...

Ngày tải lên : 20/06/2014, 04:20

8
547
0

báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pdf

... article as: Hughes-Fulford and Li: The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization Journal of Orthopaedic Surgery and Research 2011 6:8 Submit ... Figure FGF-2 and BMP-2, the yin and yang of mineralization: Contrast of effect of 24 hours of treatment with FGF-2 or BMP2 on fold increase in...

Ngày tải lên : 20/06/2014, 07:20

8
460
0

Regulation of DNA (cytosine 5) methyltransferase 1 in the cell cycle and its role(s) in doxorubicin mediated micronuclei formation

... over-expression of p21WAF1 inhibits DNMT1 73 3 .1. 1.7 TSA -mediated induction of p21WAF1 results in inhibition of 76 DNMT1 3 .1. 1.8 TSA -mediated induction of p21WAF1 is independent of p53 85 3 .1. 2 Transcriptional ... between DNMT1 and p21WAF1 in the 63 cell cycle 3 .1. 1 .1 3 .1. 1.2 DNMT1 expression in the cell cycle 63 WAF1 in DNA 67 p21WAF1 68 Tran...

Ngày tải lên : 14/09/2015, 14:13

208
387
0

The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

... function upstream of the effector caspases in apoptosis and are known as initiator caspases A phylogenetically distinct group of 13 caspases (caspase- 1, caspase- 4, caspase- 5, caspase- 11 and caspase- 12 ) ... caspase- 1 to an influenza A/ Puerto Rico/8/34 (H1N1) virus infection of RAW264.7 murine macrophages, in vitro To investigate the role of ca...

Ngày tải lên : 13/10/2015, 16:41

190
824
0

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCA...

Ngày tải lên : 18/02/2014, 18:20

12
613
0

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identiﬁed and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên : 07/03/2014, 21:20

12
561
0

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

... Colosia AD, Donahue JP, Lin YZ, Hawiger J: Regulation of NF-kappa B, AP-1, NFAT, and STAT1 nuclear import in T lymphocytes by noninvasive delivery of peptide carrying the nuclear localization ... stress-activated protein kinases, also called cJun NH2-terminal kinases (JNKs); and the p38 MAPKs [13] The JNK pathway is of interest because of its capacity to phosphorylat...

Ngày tải lên : 09/08/2014, 07:20

10
462
0

Báo cáo khoa học: "The Akt-inhibitor Erufosine induces apoptotic cell death in prostate cancer cells and increases the short term effects of ionizing radiation" pot

... analyzed whether treatment with the Akt-inhibitor ErPC3 would increase the short- time antineoplastic effects of ionizing radiation in the prostate cancer cell lines Combined treatment with ErPC3 and ... reduced the number of viable LNCaP, PC3 and DU145 cells as determined by the WST-1 test In PC3 and DU145 cells the antineoplastic effects of th...

Ngày tải lên : 09/08/2014, 09:20

12
343
0

báo cáo khoa học: "Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin" pot

... participated in the synchronization and RNA-extraction and in the interpretation of the data JG and LDV participated in the design of the experiments DI and WV conceived and supervised the study ... Vannerum et al.: Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), w...

Ngày tải lên : 11/08/2014, 11:21

17
562
0

báo cáo khoa học: "The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress" ppt

... Open Access The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress ... this article as: Galbiati et al.: The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulati...

Ngày tải lên : 11/08/2014, 11:21

15
316
0

the role of fgfr3 mutation in tumour initiation, progression and invasion of urothelial cell carcinoma in mice

... The role of FGFR3 mutation in tumour initiation, progression and invasion of urothelial cell carcinoma in mice Mona Foth Submitted in fulfilment of the requirements for the Degree of PhD ... at the signalling downstream Thirdly, we examined the role of the most common mutation in FGFR3, S249C, in the urothelium and in tumour...

Ngày tải lên : 22/12/2014, 20:56

280
292
0

Development of sphingosine kinase (SPHK) inhibitors and the role of sphingolipids in adult stem cell proliferation and differentiation 2

... (m, 22 H), 0. 92 (t, 3H); 13C NMR (300 MHz, C6D6) δ 154.8, 94.6, 85.6, 80 .2, 79.7, 79 .2, 65.0, 64 .2, 63.8, 63 .2, 62. 8, 61.9, 32. 0, 29 .8, 29 .6, 29 .4, 29 .2, 28 .9, 28 .7, 28 .0, 25 .8, 25 .4, 23 .2, 22 .7, ... 64.44% 72. 98% 63.88% Structures of six obtained compounds (analogues of sphingosine) 2. 2 .2 Compounds Inhibitory Function on SPHK Activity in vitro 2. 2...

Ngày tải lên : 11/09/2015, 16:06

32
310
0