Characterization of human adipose tissue derived adult multipotent precursor cells

... CHARACTERIZATION OF HUMAN ADIPOSE DERIVED ADULT MULTIPOTENT PRECURSOR CELLS LEONG TAI WEI DAVID (Bachelor of Chemical Engineering, Hons) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... of stem cells in regeneration of bone 1-1 1-1 1-2 Chapter – Literature Review 2.1 Description of the adipose tissue 2.2 Adipose tissue – a possible alternat...

Ngày tải lên: 12/09/2015, 09:55

... About a month prior to presentation, she again started having hip pain radiating to the anterior region of the right knee The pain was worse when standing up, walking, and exercising The pain improved ... After cleaning with povodine-iodine and draping with sterile drapes, her knee was anesthetized with 2% lidocaine at the medial and lateral sides of the inferior patel...

Ngày tải lên: 10/08/2014, 23:21

... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and it...

Ngày tải lên: 19/02/2014, 02:20

... this article as: Lechner et al.: Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse ... serum and regulated by association of a latency protein, precluded clear neutralization data Characterization of human CD33+ and CD1...

Ngày tải lên: 18/06/2014, 19:20

... this article as: Yang et al.: High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells Journal of Biomedical Science 2011 18:59 Submit your next manuscript ... differentiation of cryopreserved human adipose-derived stem cells Cryobiology 2008, 57:18-24 Chen MY, Lie PC, Li ZL, Wei X: Endothelial differentiation of...

Ngày tải lên: 10/08/2014, 10:20

... LIST OF PUBLICATION AND PRESENTATIONS Characterization of human umbilical cord lining derived epithelial cells and transplantation potential Zhou Y, Gan S U, Lin G, Lim Y T, Masilamani J, Mustafa ... immunogenicity of human umbilical cord lining derived stem cells Zhou Y, Phan T T, Gan S U, Calne R, Lee K O and MacAry P A (2006) Abstract presented at Wo...

Ngày tải lên: 11/09/2015, 10:02

... good source of multipotent adult stem cells is the adipose tissue Cells isolated from these, known as ADSCs (Adipose Derived Stromal Cells) have been shown to possess the property of being multipotent ... precursor cells called Adipose tissue derived cells (ADSCs) (Zuk PA et al., 2001) These cells have variably been known as Processed Lipoaspirate (PLA), adipose ti...

Ngày tải lên: 08/11/2015, 17:01

... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocyt...

Ngày tải lên: 25/10/2012, 11:10

... Mapping of transcription initiation sites in the human DNASE1 gene To identify the transcription initiation sites of DNASE1 in pancreas, 5¢-RACE based on RNA ligasemediated and oligo-capping ... including characterization of the promoter region of the gene and the associated transcriptional factors Therefore, delineation of the transcriptional Promot...

Ngày tải lên: 19/02/2014, 06:20

... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human A...

Ngày tải lên: 19/02/2014, 07:20

... hMnSOD has a low level of product inhibition, similar to that of the parent mutant Q143A hMnSOD, while exhibiting higher catalytic activity and efficiency Although even higher catalytic activity would ... efficiency and similarly low product inhibition compared with the Q143A hMnSOD parent Our results demonstrate the ability of directed evolution to engineer variants...

Ngày tải lên: 07/03/2014, 11:20

... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Fur...

Ngày tải lên: 16/03/2014, 06:20

... location of the nuclei in these cells These results confirm that the cells isolated by our procedure are endothelial cells from the vein of human umbilical cord Flow cytometry of endothelial cells ... report of the molecular expression of AChE in human endothelial cells, more precisely in human umbilical vein endothelial cells We have also performed an enzymatic...

Ngày tải lên: 16/03/2014, 23:20

... volume and energetic properties of the binding of CO to hemoproteins Biophys J 66, 89–98 Tuckey RC & Kamin H (1983) Kinetics of O2 and CO Binding to adrenal cytochrome P-450scc Effect of cholesterol, ... was in the range of values determined in previous studies for the interaction between bovine Adx and bCYP11B1 Biacore measurements were performed to investigate the bindin...

Ngày tải lên: 30/03/2014, 04:20