Characterization of human adipose tissue derived adult multipotent precursor cells

Characterization of human adipose tissue derived adult multipotent precursor cells

Characterization of human adipose tissue derived adult multipotent precursor cells

... CHARACTERIZATION OF HUMAN ADIPOSE DERIVED ADULT MULTIPOTENT PRECURSOR CELLS LEONG TAI WEI DAVID (Bachelor of Chemical Engineering, Hons) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... of stem cells in regeneration of bone 1-1 1-1 1-2 Chapter – Literature Review 2.1 Description of the adipose tissue 2.2 Adipose tissue – a possible alternat...

Ngày tải lên: 12/09/2015, 09:55

195 653 0
Báo cáo khoa học: "Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series" docx

Báo cáo khoa học: "Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series" docx

... About a month prior to presentation, she again started having hip pain radiating to the anterior region of the right knee The pain was worse when standing up, walking, and exercising The pain improved ... After cleaning with povodine-iodine and draping with sterile drapes, her knee was anesthetized with 2% lidocaine at the medial and lateral sides of the inferior patel...

Ngày tải lên: 10/08/2014, 23:21

8 293 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and it...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx

Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx

... this article as: Lechner et al.: Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse ... serum and regulated by association of a latency protein, precluded clear neutralization data Characterization of human CD33+ and CD1...

Ngày tải lên: 18/06/2014, 19:20

20 575 0
Báo cáo y học: " High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells." ppsx

Báo cáo y học: " High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells." ppsx

... this article as: Yang et al.: High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells Journal of Biomedical Science 2011 18:59 Submit your next manuscript ... differentiation of cryopreserved human adipose-derived stem cells Cryobiology 2008, 57:18-24 Chen MY, Lie PC, Li ZL, Wei X: Endothelial differentiation of...

Ngày tải lên: 10/08/2014, 10:20

9 519 0
Immunological characterization of human umbilical cord lining derived cells and their therapeutic application in a diabetic mouse model

Immunological characterization of human umbilical cord lining derived cells and their therapeutic application in a diabetic mouse model

... LIST OF PUBLICATION AND PRESENTATIONS Characterization of human umbilical cord lining derived epithelial cells and transplantation potential Zhou Y, Gan S U, Lin G, Lim Y T, Masilamani J, Mustafa ... immunogenicity of human umbilical cord lining derived stem cells Zhou Y, Phan T T, Gan S U, Calne R, Lee K O and MacAry P A (2006) Abstract presented at Wo...

Ngày tải lên: 11/09/2015, 10:02

226 362 0
Investigation of osteogenic characteristics of human adipose derived stromal cells

Investigation of osteogenic characteristics of human adipose derived stromal cells

... good source of multipotent adult stem cells is the adipose tissue Cells isolated from these, known as ADSCs (Adipose Derived Stromal Cells) have been shown to possess the property of being multipotent ... precursor cells called Adipose tissue derived cells (ADSCs) (Zuk PA et al., 2001) These cells have variably been known as Processed Lipoaspirate (PLA), adipose ti...

Ngày tải lên: 08/11/2015, 17:01

112 284 0
Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"

Báo cáo y học: "Characterization of Human Erythrocytes as Potential Carrier for Pravastatin: An In Vitro Study"

... of pravastatin in human erythrocytes The current work studies effect of time, temperature as well as drug concentration on the process of pravastatin loading into human erythrocytes by endocytosis ... characterization of pravastatin loaded erythrocytes Hematological Indices To determine the effect of loading process on erythrocytes, normal erythrocytes, erythrocyt...

Ngày tải lên: 25/10/2012, 11:10

9 829 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... Mapping of transcription initiation sites in the human DNASE1 gene To identify the transcription initiation sites of DNASE1 in pancreas, 5¢-RACE based on RNA ligasemediated and oligo-capping ... including characterization of the promoter region of the gene and the associated transcriptional factors Therefore, delineation of the transcriptional Promot...

Ngày tải lên: 19/02/2014, 06:20

12 610 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human A...

Ngày tải lên: 19/02/2014, 07:20

11 625 0
Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

Báo cáo khoa học: Engineering and characterization of human manganese superoxide dismutase mutants with high activity and low product inhibition potx

... hMnSOD has a low level of product inhibition, similar to that of the parent mutant Q143A hMnSOD, while exhibiting higher catalytic activity and efficiency Although even higher catalytic activity would ... efficiency and similarly low product inhibition compared with the Q143A hMnSOD parent Our results demonstrate the ability of directed evolution to engineer variants...

Ngày tải lên: 07/03/2014, 11:20

9 416 0
Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Fur...

Ngày tải lên: 16/03/2014, 06:20

14 546 0
Báo cáo khoa học: Biochemical characterization of human umbilical vein endothelial cell membrane bound acetylcholinesterase ppt

Báo cáo khoa học: Biochemical characterization of human umbilical vein endothelial cell membrane bound acetylcholinesterase ppt

... location of the nuclei in these cells These results confirm that the cells isolated by our procedure are endothelial cells from the vein of human umbilical cord Flow cytometry of endothelial cells ... report of the molecular expression of AChE in human endothelial cells, more precisely in human umbilical vein endothelial cells We have also performed an enzymatic...

Ngày tải lên: 16/03/2014, 23:20

11 365 0
Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

... volume and energetic properties of the binding of CO to hemoproteins Biophys J 66, 89–98 Tuckey RC & Kamin H (1983) Kinetics of O2 and CO Binding to adrenal cytochrome P-450scc Effect of cholesterol, ... was in the range of values determined in previous studies for the interaction between bovine Adx and bCYP11B1 Biacore measurements were performed to investigate the bindin...

Ngày tải lên: 30/03/2014, 04:20

12 428 0
w