Characterization of helicobacter pylori y glutamyl transpeptidase and its role in pathogenesis

... assay 57 3.5.2 Growth of different H pylori strains 57 3.5.3 Inhibitory effect of serine borate complex on H pylori GGT activity 58 3.5.4 Stimulatory effect of GSH and glycyl-glycine on H pylori ... activity of H pylori 100 4.2.2.2 GSH enhances the GGT acitivity of H pylori 101 4.2.2.3 Effects of GGT inhibitor and enhancer on the growth of H pylori 102 4.3 Sequen...

Ngày tải lên: 12/09/2015, 09:55

... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human A...

Ngày tải lên: 19/02/2014, 07:20

... of the A12L proteolysis from other major core precursors Moreover, Kinetic analysis and pulse chase of A12L protein Figure Kinetic analysis and pulse chase of A12L protein A To determine kinetic ... Figure Proteolysis of A12L Proteolysis of A12L In order to characterize the proteolytic processing of A12L, we examined the utilization of each AG/X site...

Ngày tải lên: 18/06/2014, 18:20

... of the A12L proteolysis from other major core precursors Moreover, Kinetic analysis and pulse chase of A12L protein Figure Kinetic analysis and pulse chase of A12L protein A To determine kinetic ... Figure Proteolysis of A12L Proteolysis of A12L In order to characterize the proteolytic processing of A12L, we examined the utilization of each AG/X site...

Ngày tải lên: 20/06/2014, 01:20

... DETECTION, FORMATION AND REACTIVITY OF TETRAVALENT LEAD CORROSION PRODUCT (PbO2) AND ITS ROLE IN WATER QUALITY IN DRINKING WATER DISTRIBUTION SYSTEM NAME: ZHANG YUANYUAN ... critical role in regulating lead contamination in drinking water, a precise and fast method for its detection is required to determine its abundance in drink...

Ngày tải lên: 30/09/2015, 06:15

... sufficient for arginase activity, and that the enzyme has a number of interesting and unique features among the arginase superfamily, including optimal enzymatic activity with cobalt rather than manganese, ... concentration of 0.20–0.25 mM), 50–100 pmol of each primer, and 2.5 U of thermostable DNA polymerase E coli was transformed by the calcium chloride method...

Ngày tải lên: 16/03/2014, 16:20

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins,...

Ngày tải lên: 23/03/2014, 17:21

... molecular chaperones in the folding of oxidized proteins Refolding of colloidal thyroglobulin by protein disulfide isomerase and immunoglobulin heavy chain-binding protein J Biol Chem 2001, 276:21337-21342 ... Mechanism of hepatocellular dysfunction during early sepsis: key role of increased gene expression and release of proinflammatory cytokines tumor necrosis...

Ngày tải lên: 13/08/2014, 11:22

... CHARACTERIZATION OF RAB2 2B, AN ASTROGLIAENRICHED RAB GTPASE, AND ITS ROLE IN GOLGI AND POST -GOLGI MEMBRANE TRAFFIC NG, EE LING B APP SC (HONS) (QUEENSLAND UNIVERSITY OF TECHNOLOGY) ... 1.1 An overview of Rab GTPases and membrane trafficking The enormous flux of membrane traffic within a cell at any point of its existence necessitates stri...

Ngày tải lên: 12/09/2015, 09:55

... Adsorption of water vapour onto type A silica gel at 50 C 20mbar 57 Adsorption diffusivity of water vapor onto type RD silica gel 58 Adsorption diffusivity of water vapor onto type A silica gel ... PROPERTIES OF SILICA GEL 28 3.1 The Preparation Of Silica Gel 28 3.2 The Physical Properties Of Silica Gel 29 3.3 Adsorption Characteristics O...

Ngày tải lên: 03/10/2015, 20:32

... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We defined the binding core regi...

Ngày tải lên: 14/02/2014, 19:20

... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCA...

Ngày tải lên: 18/02/2014, 18:20

... interface formed in the tetramer would disrupt copper < /b> binding < /b> Inhibition of amyloid fibril formation by < /b> stefin < /b> B in presence of copper < /b> The mechanism of amyloid fibril formation of cystatins is being studied ... histidine residues are central to copper < /b> binding < /b> in many proteins they probably form part of the copper < /...

Ngày tải lên: 19/02/2014, 06:20

... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of...

Ngày tải lên: 20/02/2014, 11:20