Báo cáo khoa học: Purification and characterization of Helicobacter pylori arginase, RocF: unique features among the arginase superfamily doc

Eur J Biochem 271, 1952–1962 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04105.x Purification and characterization of Helicobacter pylori arginase, RocF: unique features among the arginase superfamily David J McGee1, Jovanny Zabaleta2, Ryan J Viator3, Traci L Testerman1, Augusto C Ochoa2,4 and George L Mendz5 Department of Microbiology & Immunology, University of South Alabama, College of Medicine, Mobile, AL, USA; 2Department of Pathology and Tumor Immunology Program, Stanley S Scott Cancer Center, Louisiana State University, Health Sciences Center, New Orleans, LA, USA; 3Department of Biological Sciences, University of South Alabama, College of Arts & Sciences, Mobile, AL, USA; 4Tumor Immunology Program, Stanley S Scott Cancer Center and Department of Pediatrics, Louisiana State University, Health Sciences Center, New Orleans, LA, USA; 5School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW, Australia The urea cycle enzyme arginase (EC 3.5.3.1) hydrolyzes L-arginine to L-ornithine and urea Mammalian arginases require manganese, have a highly alkaline pH optimum and are resistant to reducing agents The gastric human pathogen, Helicobacter pylori, also has a complete urea cycle and contains the rocF gene encoding arginase (RocF), which is involved in the pathogenesis of H pylori infection Its arginase is specifically involved in acid resistance and inhibits host nitric oxide production The rocF gene was found to confer arginase activity to Escherichia coli; disruption of plasmid-borne rocF abolished arginase activity A translationally fused His6–RocF was purified from E coli under nondenaturing conditions and had catalytic activity Remarkably, the purified enzyme had an acidic pH optimum of 6.1 Both purified arginase and arginasecontaining H pylori extracts exhibited optimal catalytic activity with cobalt as a metal cofactor; manganese and nickel were significantly less efficient in catalyzing the hydrolysis of arginine Viable H pylori or E coli containing rocF had significantly more arginase activity when grown with cobalt in the culture medium than when grown with manganese or no divalent metal His6–RocF arginase activity was inhibited by low concentrations of reducing agents Antibodies raised to purified His6–RocF reacted with both H pylori and E coli extracts containing arginase, but not with extracts from rocF mutants of H pylori or E coli lacking the rocF gene The results indicate that H pylori RocF is necessary and sufficient for arginase activity and has unparalleled features among the arginase superfamily, which may reflect the unique gastric ecological niche of this organism Helicobacter pylori causes gastritis [1], is strongly associated with the development of peptic ulcers [2], and constitutes a risk factor for gastric adenocarcinoma [3,4] The mechanisms leading to the development of these diseases are not well understood, but urease, which catalyzes the hydrolysis of urea to carbon dioxide and ammonium, is critical in the pathogenesis of H pylori infection [5,6] The role of other H pylori nitrogen-metabolizing proteins in virulence has only recently begun to be understood [7,8] Together with ornithine, urea is synthesized from the catabolism of arginine by the urea cycle enzyme arginase (L-arginine ureohydrolase, EC 3.5.3.1) [9–11] Arginase, discovered 100 years ago [12], was one of the first enzymes shown to require divalent cations for catalytic activity [13] Eukaryotic arginases have a highly alkaline pH optimum (pH 9.0–11.0) and require manganese for optimal catalytic activity [14–21] However, other divalent metal cations (e.g cobalt and nickel) can activate some arginases that first have been dialyzed or treated with chelators to remove the manganese [13,18,19] Arginases generally lose significant catalytic activity during dialysis owing to the loss of the divalent metal cation [15,19] Reducing agents have little or no effect on the activity of these enzymes [22,23] In contrast to the well-characterized mammalian arginases, relatively few prokaryotic arginases have been purified and characterized Of those that have been purified and characterized, most are from the genus Bacillus; like eukaryotic arginases, these prokaryotic arginases were found to have an optimal catalytic activity with manganese and showed a highly alkaline (pH 9.0–11.0) pH optimum [17,24–27] In the presence of high concentrations of reducing agents, only modest inhibition of B brevis and B anthracis arginase was observed [26,27], whereas B licheniformis arginase was Correspondence to D J McGee, University of South Alabama College of Medicine, Department of Microbiology & Immunology, 307 N University Blvd, Mobile, AL 36688, USA Fax: + 251 460 7931, Tel.: + 251 460 7134, E-mail: dmcgee@jaguar1.usouthal.edu Abbreviation: CBA, Campylobacter agar containing 10% (v/v) defibrinated sheep blood Enzyme: arginase (EC 3.5.3.1) Note: A website is available at http://www.southalabama.edu/ microbiology/mcgee.html (Received 10 February 2004, revised 16 March 2004, accepted 23 March 2004) Keywords: Helicobacter pylori; cobalt; arginase; urea; ornithine Ó FEBS 2004 Characterization of H pylori arginase (Eur J Biochem 271) 1953 completely resistant to inhibition by mM 2-mercaptoethanol [25] H pylori arginase produces endogenous urea that can be utilized by urease to generate ammonium and carbon dioxide, with concomitant acid resistance [8] In addition to producing endogenous urea, H pylori may also obtain some of its urea exogenously from the host, as urea is present in the gastric mucosa through host arginase activity [10,28] Presently, it is unclear how much endogenous vs exogenous urea is utilized by the abundant urease of H pylori Exogenous urea is thought to be imported into H pylori through the UreI transporter, under acidic conditions [29], but this system may be inoperable in vivo under neutral pH conditions Thus, arginase may be important for providing endogenous urea in vivo under conditions in which exogenous urea is limited Another biological role of arginase is to regulate cytosolic arginine and ornithine levels, which are required for numerous metabolic processes, such as protein synthesis, and production of polyamines and nitric oxide [30] Previous studies have pointed to the role of H pylori arginase in acid resistance [8] H pylori arginase also inhibits host nitric oxide production, helping to escape the toxic effects of nitric oxide, while outcompeting the host for the limited arginine available [7] Arginase also plays a role in inhibiting T cell proliferation by reducing expression of CD3f (J Zabaleta, D McGee & A Ochoa, unpublished observations) Thus, evidence is accumulating that H pylori arginase plays important roles in pathogenesis Previously, the rocF gene of H pylori was cloned and the gene disrupted in three strains [8] While the gene was found to be required for arginase activity, the study did not establish whether expression of rocF alone in Escherichia coli was sufficient for arginase activity To characterize this important enzyme and understand further the mechanisms of arginase-mediated pathogenesis, the H pylori RocF protein was purified and its biochemical properties investigated This study demonstrates that RocF is necessary and sufficient for arginase activity, and that the enzyme has a number of interesting and unique features among the arginase superfamily, including optimal enzymatic activity with cobalt rather than manganese, inhibition by reducing agents, and a pH optimum considerably lower than that of previously characterized arginases Materials and methods H pylori strains were cultured at 37 °C on Campylobacter agar containing 10% (v/v) defibrinated sheep blood (CBA) in a microaerobic environment for 2–3 days using the CampyPak Plus system (Becton Dickinson), or in 5% (v/v) CO2 in humidified air Kanamycin (5–10 lgỈmL)1) was added to the growth medium, as appropriate The strains employed in this study were wild type SS1 and its isogenic rocF::aphA3 mutant, and wild type ATCC 43504 and its isogenic rocF::aphA3 mutant [8] Molecular biology techniques Plasmid DNA was isolated by the alkaline lysis method [31], or by column chromatography (Qiagen) for sequencinggrade plasmid Restriction endonuclease digests, ligations and other enzyme reactions were conducted according to the manufacturer’s instructions (Promega) PCR reactions (50 lL) contained 10–100 ng of DNA, PCR buffer, 2.0– 2.5 mM MgCl2, dNTPs (each nucleotide at a concentration of 0.20–0.25 mM), 50–100 pmol of each primer, and 2.5 U of thermostable DNA polymerase E coli was transformed by the calcium chloride method Construction of the arginase mutant of H pylori 43504 Plasmid pBS-rocF::aphA3 was transformed into H pylori 43504 by electroporation [8] to generate an arginasenegative mutant (rocF::aphA3) The mutant was confirmed by PCR analysis, as described previously [8] Cloning of rocF into pQE30 The rocF gene, from nucleotides 1–967 of the coding region, was PCR-amplified using primers RocF-F6 (gcggatccAT GATTTTAGTAGGATTAGAAGCAGAG; BamHI site underlined; non-rocF sequence in lower case) and Roc F-R8 (gcctgcagAGTAACTCCTTGCAAAAGAGTGCT TC; PstI site underlined; non-rocF sequence in lower case) The PCR product was purified, phenol/chloroform extracted, and precipitated with ethanol After digestion with BamHI and PstI, the product was cloned into pQE30 (Qiagen), predigested with the same enzymes, to generate pQE30-rocF The construct was confirmed by sequencing, restriction enzyme digestion, and mini-protein expression analyses (data not shown) The fusion protein, His6-RocF, has a predicted molecular mass of 37.8 kDa Bacterial strains, growth conditions, and plasmids Purification of RocF E coli strain XL1-Blue MRF¢ [thi-1, gyrA96, recA1, endA1, relA1, supE44, lac, hsdR17 (r–, m+), F¢ [proAB, lacIq Z DM15, Tn10 [tetr]] was used for overexpressing H pylori RocF for purification purposes Strain DH5a [F–, deoR, thi-1, gyrA96, recA1, endA1, relA1, supE44D (lacZYA-argF) U169, hsdR17(r–, m+), /80 dlacZ DM15, k–] was used for standard cloning and transformation procedures E coli strains were grown at 37 °C on Luria (L) agar and in L broth plus appropriate antibiotics (100 lgỈmL)1 ampicillin, 25 lgỈmL)1 kanamycin, 10 lgỈmL)1 tetracycline) Plasmids pBS [pBluescript II SK(+); Stratagene], pBS-rocF [8], pBS-rocF::aphA3 [8], pQE30 (Qiagen) and pQE30-rocF (see below) were used in this study XL1-Blue MRF¢ pQE30-rocF (1.5 L) was grown to mid-log phase and induced with mM isopropyl thio-b-D-galactoside Cultures were harvested in Wash Buffer (50 mM NaH2PO4, 300 mM NaCl, 15 mM imidazole, pH 8.0), lysed by two passages through a French Press (16 000 psi) on ice, clarified by centrifugation, and the cytosolic portion loaded onto polypropylene columns (8.5 · 2.0 cm) containing nickel-nitrilotriacetic acid agarose resin ( mL per 10 mg of protein) (Qiagen) The flow-through was retained to monitor binding of arginase to the column Following six to eight washes with 10 mL of Wash Buffer, RocF was eluted with Elution Buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0) in mL fractions All Ó FEBS 2004 1954 D J McGee et al (Eur J Biochem 271) manipulations were performed at °C to minimize loss of enzyme activity Fractions were analyzed for the presence of the His6-RocF by SDS/PAGE (expected molecular mass: 37.8 kDa) and colorimetric arginase activity For long-term storage, glycerol was added to a final concentration of 50% and the enzyme stored at )20 °C CuSO4Ỉ5H2O The reducing agents dithiothreitol or 2-mercaptoethanol were mixed with the enzyme in the presence of CoCl2 In control tubes, dithiothreitol or 2-mercaptoethanol was replaced with the same volume of sterile water Kinetic analyses Preparation of arginase-containing extracts Bacteria were harvested in 0.9% NaCl and ice-bathsonicated (25% intensity, two pulses of 30 s each, with 30 s rests on ice between pulses) Following centrifugation (12 000 g, min, °C), supernatants were retained on ice or frozen at )20 °C until measurement of arginase activity No arginase activity was detected in the corresponding pellets Proton NMR spectroscopy ([1H]NMR) was employed to measure purified arginase activity, as previously described [26] The kinetic constants, Km and Vmax, were determined by nonlinear regression analysis, employing the program ENZYME KINETICS (Trinity Software, Campton, NH, USA) The activity of the enzyme was measured at pH 7.1 and 37 °C at arginine concentrations of 2, 5, 10, 15, 20, 30, 50, 70, and 100 mM Errors are quoted as SD values Arginase activity assay The colorimetric arginase assay measures the amount of ornithine by the appearance of an orange color (read spectrophotometrically at 515 nm) from the reaction of ornithine with ninhydrin at low pH Equal volumes of extract and 10 mM cobaltous chloride (CoCl2Ỉ6H2O, final concentration mM) were preincubated for 30 at 50–55 °C to activate the enzyme (heat-activation step; 50 lL final volume) The heat activation of arginases in the presence of metal cofactor is well documented in the literature [16] and was first observed by Mohamed & Greenberg [19] Next, arginase buffer [15 mM Tris, pH 7.5, or 15 mM Mes, pH 6.0, plus 10 mM L-arginine (unless otherwise stated)] was added and incubation continued at 37 °C The arginine concentration could not be increased beyond 10 mM without significant increase in background (data not shown) After h the reaction was stopped by the addition of 750 lL of acetic acid, and the color developed by the addition of 250 lL of ninhydrin (4 mgỈmL)1) at 95 °C for h A standard curve of different ornithine concentrations (3125–391 lM in serial twofold dilutions) was used to generate a slope (typically 0.00045– 0.00070 lM)1) The data are presented in U, where U is defined as pmol L-ornithine min)1Ỉmg)1 of protein (± SD) The enzyme activity was shown to be linear under these conditions An abbreviated description of a preliminary version of this assay has been previously reported [11] For experiments to determine pH optimum, buffers (15 mM) of the appropriate pKa were employed Homopipes (pH 4.0–5.0), Mes (pH 5.5–6.7), Mops (pH 6.7–7.3), or Tris (pH 7.0–9.0), of the desired pH, were obtained by addition of concentrated HCl or 10 M NaOH to the buffer after the addition of arginine (10 mM) Mes and Mops buffers, at pH 6.7, resulted in identical arginase activities, whereas Tris (pH 7.3) resulted in 20% more activity than Mops (pH 7.3); this buffer effect was corrected to allow comparison of activities at different pH values For determining the temperature optimum, the enzymecontaining samples were first activated with mM CoCl2, as described above, and then incubated at the desired temperature for h For determining metal ion optima, mM CoCl2 was replaced with mM MnSO4, NiCl2Ỉ 6H2O, ZnCl2, FeSO4Ỉ7H2O, CaCl2Ỉ2H2O, MgSO4, or Arginase activity in viable E coli Cultures of E coli were grown overnight at 37 °C with aeration (225 r.p.m.), in L broth plus ampicillin, in the presence or absence of cobalt or manganese (the concentrations used are listed in the Figure legends) Metal concentrations higher than 500 lM could not be reliably tested owing to adverse effects on E coli growth Cultures were harvested, washed, and resuspended in ice-cold 0.9% (w/v) NaCl Viable E coli cells were added to arginase buffer (15 mM Mes, pH 6.0, containing 10 mM L-arginine) No divalent metal cation was added, nor was heatactivation conducted After h at 37 °C, the assay was stopped and the ornithine concentration was analysed, as described above Under these experimental conditions, it is assumed that the viable bacteria transport arginine intracellularly, where it is hydrolyzed by cytosolic holo-arginase (already contains metal cofactor) to yield ornithine Arginase activity in viable H pylori Cultures of H pylori strain 43504 were grown at 37 °C with aeration (225 r.p.m.), in a microaerobic environment (Campy Pak Plus in an anaerobic jar), for 24 h in mL of Ham’s F-12 plus 1% (v/v) fetal bovine serum in the presence or absence of cobalt, manganese or nickel (1 lM) Metal concentrations greater than lM could not be reliably tested owing to adverse effects on H pylori growth Cultures were harvested, washed and resuspended in ice-cold 0.9% (w/v) NaCl Viable H pylori cells were added to arginase buffer (50 mM potassium phosphate, pH 7.5, plus 10 mM L-arginine) No divalent metal cation was added, nor was heat-activation conducted After h at 37 °C, the assay was stopped and the concentration of ornithine determined, as described above This assay assumes that, under these experimental conditions, viable H pylori transport arginine into the cell where it is hydrolyzed by holo-arginase Preliminary experiments indicated that lysing the bacteria with SDS (0.4%, w/v) at the end of the assay did not affect the amount of ornithine detected, verifying that the ornithine produced was available for detection by the ninhydrin reagent Ó FEBS 2004 Characterization of H pylori arginase (Eur J Biochem 271) 1955 Raising of antibodies to RocF Polyclonal antibodies were raised by GeneMed Synthesis Inc (San Francisco, CA) on a fee-for-service basis RocF was emulsified with complete Freund’s adjuvant, and injected four times intradermally along the back of two adult New Zealand white rabbits Booster immunizations were conducted with RocF emulsified in incomplete Freund’s adjuvant Immune sera were collected 12 weeks postimmunization, and the antisera titer determined (using purified RocF) via Western blot analysis Four to five milligrams of  95% pure protein was used for the immunization Preimmune sera were isolated from rabbits as a negative control The company has an Animal Assurance number filed with USDA and an approved animal protocol through its institutional animal care and use committee Protein determinations The protein concentration was determined using the bicinchoninic acid assay (Pierce Chemical Company), following the manufacturer’s 30 method BSA was used as the standard Fig Characterization of Helicobacter pylori arginase using a colorimetric enzyme assay Extracts from wild type H pylori strain 43504 (wt) or the isogenic rocF::aphA3 mutant (rocF) were heat-activated for 30 in the presence of mM CoCl2 (Co) The temperature of heat activation was 50 °C (designated as 50), 42 °C (designated as 42) or 37 °C (designated as 37) Arginase activity was measured in 15 mM Tris (pH 7.5) containing 10 mM L-arginine, for h The values shown are the mean ± SD of one representative experiment, conducted in duplicate At least two experiments (independently prepared extracts) were conducted for each sample Lack of error bars on some values indicate that the standard deviation was too small to appear on the graph No arg, no arginine added to enzyme assay buffer; No Co, no cobalt added during the heat activation step SDS/PAGE and Western blotting analysis Proteins were electrophoresed through an SDS-polyacrylamide gel and transferred to methanol-treated poly(vinylidene difluoride) membrane using the Trans-blot cell transfer system (Bio-Rad) Blots were blocked in 5% (w/ v) nonfat dry milk in Tris-buffered saline containing 0.5% (v/v) Tween-20 (TBST-1) Primary antisera (1 : 2500, v/v) were incubated for h Following three washes with TBST2 [TBS containing 0.05% (v/v) Tween-20], goat anti-rabbit IgG-conjugated alkaline phosphatase (Sigma Immunochemical Co.; : 5000–1 : 7500, v/v) was added and incubation continued for 90 The blot was washed three times with TBST-2 and equilibrated with glycine buffer [100 mM glycine, mM ZnCl2, 0.05% (w/v) sodium azide, and mM MgCl2, pH 10.4] The blot was developed with 3-indoxyl phosphate (final concentration 10 lgỈmL)1; adjusted to ·100 in water) and Nitro Blue tetrazolium (100 lgỈmL)1) in glycine buffer Results Characterization of H pylori arginase In a previous study, NMR spectroscopy was employed to measure arginase activity [8] A colorimetric assay, described previously [11], which allows higher throughput, was utilized and further developed in this study The method was validated using arginase-containing extracts from wild type H pylori First, no arginase activity was detected when arginine was omitted from the assay mixture (Fig 1) This indicates that H pylori extracts contained undetectable amounts of ornithine and that no other ornithine-generating pathways were active under the conditions of the arginase assay Heat activation of the cell extract, for 30 at 50–55 °C in the presence of cobalt, was required for optimal activity If cobalt was omitted, no activity was observed If cobalt was present, but the heat activation temperature was lowered to 42 °C or 37 °C, significantly reduced activities were observed compared to heat activation at 50 °C (Fig 1) If heat activation at 50–55 °C in the presence of cobalt was carried out for only 10 or 20 min, significantly lower arginase activities were obtained (data not shown) Thus, heat activation is time-, temperature-, and cobalt-dependent Finally, if the rocF gene was disrupted by a kanamycin resistance cassette, arginase activity was abolished These results demonstrated the validity of the assay used in this study E coli containing the cloned rocF gene from H pylori exhibited arginase activity and this activity was markedly higher when heat-activated with cobalt rather than manganese Arginase and urease are both multisubunit, metal cofactor-containing enzymes [11,32] E coli can express urease activity when transformed with eight H pylori genes: the ureABIEFGH genes in the H pylori urease locus and the nixA nickel transporter [33,34] Expression of only ureAB (urease structural genes) or ureABIEFGH in E coli yields little or no urease activity [33,35,36] because nixA is required for nickel transport into the cell, and the accessory proteins UreEFGH are needed for incorporation of nickel into the urease active site [34,37] It was unknown how many H pylori genes were required for arginase activity in E coli To address this, arginase activity was measured in an E coli strain containing the cloned H pylori arginase gene (rocF) on a plasmid, and its activity was compared with strains transformed with a vector control (pBS) or a plasmid with disrupted rocF (pBS-rocF::aphA3) E coli containing rocF (pBS-rocF) exhibited arginase activity, while arginase activity was 1956 D J McGee et al (Eur J Biochem 271) Ó FEBS 2004 extract with cobalt, generated the highest arginase activity (37 200 U) While culturing E coli pBS-rocF in the presence of manganese and then heat activating the extract with cobalt yielded high arginase activity (32 400 U), culturing E coli pBS-rocF in the presence of cobalt and then heat activating the extract with manganese yielded low arginase activity (5200 U) (Fig 2B) These results suggest that arginase may lose the metal cofactor during preparation of the extracts, requiring reintroduction of the cobalt cofactor by heat activation Transformed E coli containing rocF had higher arginase activity than H pylori Routinely, E coli and H pylori are grown under different culture conditions (e.g on different media and under different concentrations of oxygen), making a direct comparison of arginase activity in the two organisms difficult Furthermore, E coli pBS-rocF contains a very high copynumber plasmid, whereas rocF is chromosomally encoded in H pylori Nonetheless, E coli (pBS-rocF) expressing the rocF gene and grown under similar conditions to H pylori (i.e microaerobically, on CBA plates) contained at least four times more arginase activity than wild type H pylori (Fig vs Fig 2A) Arginase activities of E coli pBS-rocF grown on L agar and in L broth were similar to those of cells grown microaerobically on CBA (data not shown), indicating that, under these culture conditions, no major differences in the regulation of H pylori arginase activity occurred in the E coli model Fig Characterization of arginase in Escherichia coli containing various plasmids (A) E coli DH5a, containing the plasmids indicated in the figure, was grown overnight in L broth plus the appropriate antibiotics Extracts were prepared and arginase activity was measured for 40 min, as described in the Materials and methods The arginine concentration in the arginine buffer (Tris pH 7.5) was mM (B) E coli DH5a pBS-rocF was grown in L broth overnight in the presence or absence of cobalt or manganese (100 lM) and extracts were prepared Arginase activity was measured for 60 using 15 mM Mes, pH 6.0, containing 10 mM arginine, either without heat activation, or with heat activation in the presence of cobalt (5 mM), manganese (5 mM) or no metal barely present in the control strain (pBS) or in the strain carrying disrupted arginase (pBS-rocF::aphA3) (Fig 2A) These findings indicated that, unlike urease, the H pylori arginase gene was sufficient, by itself, to confer enzyme activity to E coli No H pylori metal transporter appears to be required for obtaining arginase activity in E coli These results not rule out the possibility that other E coli genes, similar to those of H pylori, might also contribute to arginase activity, or that arginase activity might be modulated by other H pylori genes E coli containing rocF also required heat activation in the presence of cobalt for high level activity (28 000 U with heat activation with cobalt vs 1800 U with no heat activation or cobalt; Fig 2B) Heat activation with manganese resulted in lower arginase activity (3100 U for manganese; 28 000 U for cobalt) Culturing E coli pBSrocF in the presence of cobalt, and then heat activating the Purification and catalytic activity of RocF expressed in E coli The rocF gene was translationally fused to the His6encoding construct, pQE30, and shown to be correct by sequence analysis and small scale whole-cell protein expression experiments (data not shown) Arginase activity was detected in E coli containing pQE30-rocF, but not in the strain containing the vector control, pQE30 (Fig 3, and data not shown) SDS/PAGE analyses showed an extra protein, of  40 kDa in size, in extracts from E coli pQE30rocF, but not in the strain containing the vector control, pQE30 (data not shown) His6-RocF was purified under nondenaturing conditions, as described in the Materials and methods Binding of the recombinant protein to the column was apparent from the loss of a protein of  40 kDa in the flowthrough, compared to the whole cell lysates (Fig 3) His6RocF was enriched to more than 95% purity (Fig 3) Notably, arginase retained catalytic activity during purification, with the specific activity increasing from  5000 U in the starting material to up to 100 000 U in the purified protein The specific activity of purified arginase varied in different elutions, owing to the partial inhibition of enzyme activity at high imidazole concentrations (data not shown) The first elution, containing the lowest imidazole concentration, had the highest specific activity (Fig 3) The eluted protein was diluted : with 100% sterile glycerol and stored at )20 °C The protein was found to be highly unstable It was determined that His6-RocF lost Ó FEBS 2004 Characterization of H pylori arginase (Eur J Biochem 271) 1957 Fig pH and temperature optima of purified His6-RocF Purified His6-RocF was heat-activated with CoCl2 and then assayed for arginase activity at 37 °C for 60 in arginase buffer that varied in pH (see Materials and methods) Shown is a representative of two experiments ± SD, conducted in duplicate Fig Purification of catalytically active Helicobacter pylori arginase from Escherichia coli expressing His6-RocF E coli XL1-Blue MRF¢ containing pQE30-rocF was grown in L broth plus tetracycline and ampicillin and induced with isopropyl thio-b-D-galactoside Bacteria were harvested and lysed by French Press The whole cell lysate (WCL) was separated into soluble and insoluble fractions by centrifugation The soluble fraction was loaded onto a nickel-nitrilotriacetic acid column under nondenaturing conditions and the flow-through (FT) collected The column was washed extensively, as described in the Materials and methods Only the first wash is shown (W1) His6-RocF was eluted off the column and the first four elutions (E1 to E4) are shown Each of these fractions was assayed for arginase activity The amount of protein loaded onto the SDS-polyacrylamide gel is shown at the top of the gel The His6-RocF protein, 37.8 kDa, is labeled with an arrow Arginase activity, assayed at 37 °C for h in arginase buffer (15 mM Tris pH 7.5 with 10 mM L-arginine), is shown at the bottom of each lane, rounded to the nearest 500 U The Coomassie Blue-stained SDS-polyacrylamide gel was scanned 45–65% of its activity after just months of storage at )20 °C, and over 90% of its activity after months (data not shown) Storage of purified RocF at °C instead of )20 °C resulted in > 90% loss of activity within week Dialysis of the enzyme also resulted in > 90% loss of enzyme activity (data not shown), as observed with other arginases [15,19] Attempts to retain catalytic activity of the enzyme following lyophilization were also unsuccessful Additionally, there was significant variation in specific activity from one batch of freshly purified arginase to another, which could be a result of the instability of the enzyme during purification The instability of arginase may be due to spontaneous degradation (see below) Like arginase-containing extracts from H pylori, heat activation of the purified His6-RocF for 30 at 50–55 °C in the presence of cobalt showed catalytic activity, whereas omission of cobalt yielded no arginase activity (data not shown) Additionally, no arginase activity of the purified His6-RocF was measured when arginine was omitted from the assay mixture The kinetic parameters for the purified arginase in 20 mM Mops, pH 7.1, were: Km ¼ 21.8 ± 2.3 mM and Vmax ¼ 268 600 ± 10 600 U, using [1H]NMR spectroscopy These kinetic findings are in agreement with those of the partially purified arginase reported previously [11] Throughout the study, the arginase assays were conducted at an arginine concentration of 10 mM (unless stated otherwise) Therefore, the enzyme is being assayed in the linear portion of the curve Optimal temperature, pH and salt concentration for arginase activity His6-RocF was measured at different pH values and temperatures Remarkably, the enzyme had an acidic pH optimum of 6.1, with considerable activity at pH 5.5 (Fig 4) To our knowledge, no other arginase has a pH optimum below 9.0 The temperature optimum of His6-RocF arginase activity was 30 °C (data not shown) There was no reproducible preference for temperature optimum between 25 and 42 °C for H pylori extracts (data not shown) His6-RocF arginase activity was similar across a broad salt concentration range of 6.25 to 200 mM (data not shown) Freshly prepared arginase-containing H pylori extracts also had an acidic pH optimum of 6.1, with considerable activity at pH 5.5 (data not shown); its pH curve closely mirrored the curve of purified His6-RocF (Fig 4) Activities of purified arginase and H pylori arginasecontaining extracts with divalent cations Mammalian arginases require manganese for optimal catalytic activity, although some of these arginases may be activated by cobalt or nickel, to a lesser extent [13,19] Remarkably, H pylori arginase does not have optimal catalytic activity when heat-activated with manganese Rather, both purified His6-RocF arginase and H pylori arginase-containing extracts have optimal catalytic activity when heat-activated with cobalt (Table 1) Very low activities were obtained with purified His6-RocF when cobalt was replaced with manganese or nickel (Table 1) No detectable arginase activity was found using CuSO4, ZnCl2, FeSO4, CaCl2 or MgSO4 (data not shown) Similarly, significantly less arginase activity was obtained with H pylori arginase-containing extracts when manganese or 1958 D J McGee et al (Eur J Biochem 271) Ó FEBS 2004 Table Effect of metal ions on the arginase activity of Helicobacter pylori extracts or purified His6-RocF Arginase of H pylori 43504, or purified recombinant His6-RocF, was heat-activated at 50 °C for 30 in the presence of various divalent cations, and its activity was measured as described in the Materials and methods Activity is presented as percentage of the control, with activity in the presence of cobalt (the control) set at 100% At least three experiments were conducted in duplicate; one set of representative results is shown Metal concentration H pylori RocFcontaining extract (% of control) Purified His6-RocF (% of control) CoCl2, mM No metal MnSO4, mM NiCl2, mM 100.0 2.1 20.9 29.7 100.0 0.0 14.6 6.1 nickel were the metal cofactors during the heat-activation step (Table 1) No appreciable arginase activity with other divalent cations was detected in H pylori arginase-containing extracts (data not shown) Viable H pylori and transformed E coli containing the H pylori arginase gene had significantly more arginase activity when grown with cobalt, compared to manganese or no divalent metal Although H pylori arginase has optimal catalytic activity with cobalt, it was found that low reproducible activity can be obtained if the extracts are heat-activated in the presence of manganese or nickel (Table 1) This result raised the possibility that in vitro heat activation with cobalt may not necessarily reflect the metal found in arginase in vivo To demonstrate that cobalt is the optimal metal in vivo, arginase activity was measured in viable, intact cells Bacteria were cultured overnight in media either lacking or containing cobalt, manganese, or nickel Viable bacteria were added directly to arginase buffer, in the absence of metal ions, without a heat activation step This experiment assessed whether live bacteria, which had preloaded the metal ion during overnight growth, could transport arginine into the cell during the assay and convert the arginine to ornithine via arginase The results indicated that H pylori cultured in the presence of cobalt have five- to sixfold more arginase activity than bacteria grown with manganese or no metal, and threefold more arginase activity than bacteria grown with nickel (Fig 5A) Similar findings were observed with viable E coli pBS-rocF: higher arginase activity was measured when the culture was grown with cobalt than with manganese or no metal (Fig 5B) Furthermore, there was a sharp dose-dependent increase in arginase activity when E coli (pBS-rocF) was cultured with higher concentrations of cobalt, while only a mild increase in arginase activity was observed with cultures grown in the presence of higher concentrations of manganese (Fig 5C) Taken together, these results demonstrated that H pylori arginase activity was optimal with cobalt in vivo, although they did not demonstrate directly that cobalt is, in fact, the metal found in the arginase active site in vivo Fig Arginase activity of viable Helicobacter pylori or Escherichia coli pBS-rocF grown with or without cobalt or manganese Cells were harvested and processed to measure arginase activity without lysing the bacteria, as described in the Materials and methods No heat activation was conducted, nor was divalent cation added during the arginase assay Shown is the mean ± SD of one representative experiment (of at least three carried out), conducted in duplicate The dotted line represents the detection limit of this assay (A) H pylori strain 43504 was grown in F-12 plus 1% (v/v) fetal bovine serum [41] in the presence or absence of cobalt, manganese or nickel (1 lM) (B) E coli pBS-rocF was grown in L-broth, with or without cobalt (100 lM) or manganese (100 lM) (C) E coli pBS-rocF was grown in L-broth with various concentrations of cobalt or manganese Inhibition of arginase activity by reducing agents Numerous enzymes are stabilized by the presence of reducing agents such as dithiothreitol; arginases from other Ó FEBS 2004 Characterization of H pylori arginase (Eur J Biochem 271) 1959 Fig Anti-RocF Western blot analysis of Helicobacter pylori and Escherichia coli Extracts from E coli (A, 15 lg per lane) or H pylori (B, 20 lg per lane) strains indicated on the figure were loaded onto an SDS/polyacrylamide gel, transferred to poly(vinylidene difluoride) membrane and probed with anti-RocF generated from purified His6-RocF Arrow, RocF (37 kDa); arrowhead, RocF degradation product Fig Sensitivity of arginase activity to reducing agents The reducing agents dithiothreitol (A, DTT) or 2-mercaptoethanol (B, BME), at the final concentrations indicated, were mixed with purified His6-RocF ( months old) in the presence of CoCl2 and incubated at 50 °C for 30 Arginase buffer (10 mM arginine, 15 mM Tris pH 7.5) was added and incubation continued at 37 °C for h In control tubes, dithiothreitol or 2-mercaptoethanol was replaced with the same volume of sterile water The 50% inhibitory concentration (IC50) was determined from the graph organisms retain catalytic activity in the presence of reducing agents, suggesting that these agents may protect H pylori arginase from losing activity Surprisingly, dithiothreitol did not protect the enzyme activity of purified His6-RocF Rather, dithiothreitol inhibited arginase activity in a dose-dependent manner at relatively low concentrations (Fig 6A) Similarly, another reducing agent, 2-mercaptoethanol, inhibited arginase activity in a dose-dependent manner (Fig 6B) The small increase in arginase activity at 40 lM 2-mercaptoethanol was not reproducibly obtained, nor statistically different from arginase activity in the absence of 2-mercaptoethanol Arginase activity was more sensitive to dithiothreitol than 2-mercaptoethanol, with 50% inhibitory concentrations (IC50) of 25 lM and 800 lM, respectively Control experiments showed that at concentrations used in Fig 6, dithiothreitol and 2-mercaptoethanol had no effect on the colorimetric development of ornithine, but interfered at concentrations of > 1000 lM 2-mercaptoethanol or 200 lM dithiothreitol (data not shown) Western blot analyses of H pylori and E coli extracts lacking or containing arginase activity Preimmune serum from rabbits did not react with purified RocF or with E coli arginase-containing extracts, but purified RocF protein reacted in Western blots with antiRocF immunoglobulin (data not shown) Western blot analyses using anti-RocF immunoglobulin showed that extracts from E coli (pBS-rocF) had high levels of arginase protein (Fig 7A) In contrast, extracts from E coli containing the insert-free control (pBS) or a plasmid containing the disrupted rocF gene (pBS-rocF::aphA3) had no detectable arginase protein (Fig 7A) A lower molecular weight band was observed to cross-react in extracts from E coli (pBS-rocF) (Fig 7A, arrowhead) and in the purified His6RocF (data not shown), but not in extracts from E coli (pBS) or E coli (pBS-rocF::aphA3), suggesting degradation of arginase Lower amounts of the degraded product were observed in fresh batches of purified His6-RocF compared to batches that had been stored at °C or )20 °C Arginase was detected in extracts from two wild type strains of H pylori, but not the corresponding isogenic rocF::aphA3 mutants (Fig 7B), suggesting that the anti-RocF immunoglobulins are specific for RocF Despite using more total protein from H pylori (20 lg) than from E coli (15 lg), significantly less arginase was detected in the H pylori extracts, correlating with the reduced arginase activity observed in H pylori compared with E coli (pBS-rocF) extracts Discussion In this study, H pylori arginase was purified and characterized Five lines of evidence indicated that the rocF gene encodes arginase, namely (a) disrupting the rocF gene in H pylori abolishes arginase activity (Fig 1) [8], (b) transforming E coli with a plasmid containing rocF conferred arginase activity (Fig 2A), (c) transforming E coli with a plasmid containing disrupted rocF abolished arginase activity (Fig 2A), (d) the purified His6-RocF expressed in E coli had arginase activity (Figs 3, and and Table 1), and (e) the rocF gene and RocF protein shared homology with the arginase/agmatinase superfamily [8] These results demonstrate that rocF is necessary and sufficient for arginase activity However, the results did not exclude the possibility that other gene products modulate arginase activity in H pylori 1960 D J McGee et al (Eur J Biochem 271) Urease and arginase are enzymes that require a metal cofactor E coli transformed with the genes encoding the urease structural proteins, UreA and UreB, have little or no urease activity [33,35,36] This is because of the requirements for accessory proteins to incorporate the nickel metal ion cofactor into the active site of the multimer [32], as well as a nickel transporter [34,37] In contrast with the urease system, E coli transformed with the arginase structural gene, rocF, showed enzyme activity, suggesting that either H pylori arginase does not require accessory proteins, unlike urease, or that E coli expresses proteins similar to those of H pylori that can serve as arginase accessory proteins The latter possibility is not unlikely because E coli expresses a member of the arginase superfamily, agmatinase, which is encoded by speB [38] that shares low amino acid identity with H pylori arginase Thus, accessory proteins serving to incorporate metal ions into SpeB may also be able to perform a similar function for RocF When cultured under similar conditions, E coli transformed with the rocF gene had substantially more specific arginase activity than wild type H pylori In contrast, E coli expressing the H pylori urease and nickel transporter genes from multicopy to high copy plasmids exhibited 10-fold lower urease activity than that obtained with H pylori [33] The higher arginase activity found in E coli (pBS-rocF) compared to H pylori correlated well with the greater amount of arginase protein detected in Western blots of E coli extracts relative to H pylori extracts It is possible that the difference in arginase activity between E coli and H pylori may be a result of the high copy number plasmid in E coli Inhibition of arginase activity by low concentrations of the reducing agents dithiothreitol and 2-mercaptoethanol suggested a role for disulfide bonds in the activity of the enzyme, perhaps through the interaction of the thiols with metals There is no evidence in the literature to suggest the involvement of cysteine residues in the catalytic activity of other arginases, which are either completely resistant, or only moderately sensitive to, very high concentrations of reducing agents [25,27] Indeed, multisequence alignments of the arginase family reveals no conserved cysteines [17] Thus, the potential role of cysteinyls in H pylori arginase activity is a novel feature of the arginase superfamily Sitedirected mutagenesis experiments are underway to determine whether any of the six cysteine residues in RocF are required for catalytic activity Unlike other arginases, the H pylori enzyme has optimal catalytic activity at pH 6.1, a striking pH units below the pH optimum of all other known arginases [17] The H pylori arginase retains activity at even lower pH values, a condition under which all other known arginases are catalytically inactive These characteristics suggest that H pylori arginase evolved to operate under acidic conditions encountered by the bacterium in vivo in its unique gastric niche, supporting the ability of the organism to tolerate acid stress [8] Survival of H pylori in vivo may require arginase activity in situations when urea production by the host is limited In this scenario, the H pylori arginase could provide endogenous urea for utilization by urease to generate acid-neutralizing ammonia, and thus counteract a major innate defense of the stomach – acid Ó FEBS 2004 Mammalian and other bacterial arginases require heat activation, in the presence of manganese, for optimal catalytic activity [16,19,22,25,27] Numerous studies have shown that manganese does not bind mammalian arginase very tightly, as dialysis of these enzymes results in a significant decrease in their activity [15,19] Heat activation of arginase-containing extracts, or of the purified His6-RocF protein in the presence of cobalt, was required for catalytic activity, and this treatment was time-, temperature-, and cobalt-dependent The activation step may facilitate partial unfolding of arginase to allow cobalt into the active site The divalent metal ion may not be bound tightly enough and may leach out during the preparation of extracts or the purified protein, as little or no activity occurs in the absence of cobalt The amino acid residues involved in metal binding in H pylori arginase are currently under investigation Interestingly, it has been observed that arginases with alkaline isoelectric points bind manganese more tightly than arginases with acidic or neutral isoelectric points [16] As metal-bound arginases are more stable than apoarginases, alkaline pI arginases tend to be more stable Computer analysis of H pylori arginase predicts a pI of 6.3, suggesting that it belongs to the family of weak metal-binding and less stable arginases Indeed, the catalytic activity of purified His6-RocF was unstable, suggesting that cobalt does not bind tightly to the enzyme Instability of the H pylori arginase may, in part, be due to spontaneous degradation (Fig 7A) We speculate that H pylori arginase evolved to have optimal activity with cobalt over that of manganese to avoid competing with host enzymes that contain manganese (manganoenzymes) Support for this hypothesis comes from the finding that only one known host protein contains cobalt, while multiple host proteins, such as arginase, Mnsuperoxide dismutase, Mn-catalase, and serine/threonine protein phosphatase-1, are manganoenzymes [39] Known sources of cobalt in the host are vitamin B12 (cobalamin) and methionine aminopeptidase [40] Although H pylori does not absolutely require the addition of vitamin B12 for growth in vitro [41], it is possible that in vivo the bacterium can metabolize this vitamin so that the cobalt would be available for transport into the cell with subsequent incorporation into arginase Studies are underway to explore this possibility Cobalamin binds to the stomach glycoprotein intrinsic factor which allows for its normal absorption [42] H pylori may disrupt this delicate balance by metabolizing the vitamin, removing the cobalt and incorporating the cobalt into arginase This could be a contributing factor to the vitamin B12 deficiencies often observed in H pylori-infected patients [43–45] In summary, the H pylori rocF gene encodes the urea cycle enzyme arginase, and its gene product is necessary and sufficient for arginase activity The enzyme was expressed in and purified from E coli Antibodies were successfully raised to RocF, and Western blot analyses were employed to show the expression of arginase E coli and the degradation of the recombinant enzyme Compared with other arginases, the H pylori enzyme has a number of unique features, including (a) optimal catalytic activity with cobalt rather than manganese, (b) stimulation of its activity by bicarbonate [11], (c) optimal catalytic activity at pH 6.1, rather than at pH 9.0–11.0, (d) inhibition by reducing Ó FEBS 2004 Characterization of H pylori arginase (Eur J Biochem 271) 1961 agents at low concentrations, (e) inhibition of host nitric oxide [7], and (f) protection of H pylori from acid These unique features suggest that H pylori arginase has evolved to allow the bacterium to effectively compete with the host for available substrates (arginine, cobalt), necessary for the organism to survive and proliferate in the seemingly inhospitable gastric niche Acknowledgements This work was supported with start-up funds from the University of South Alabama Department of Microbiology and Immunology and the College of Medicine, by Public Health Service grant CA101931 (to D.J.M.) from the National Institutes of Health, and the Australian Research Council (to G.L.M.) References Blaser, M.J (1990) Helicobacter pylori and the pathogenesis of gastroduodenal inflammation J Infect Dis 161, 626–633 Marshall, B.J., McGechie, D.B., Rogers, P.A & Glancy, R.J (1985) Pyloric campylobacter infection and gastroduodenal disease Med J Aust 142, 439–444 International Agency for Cancer Research (1994) Monographs on the Evaluations of Cancer Risks to Humans, Vol 61 World Health Organization, Lyon Parsonnet, J., Friedman, G.D., Vandersteen, D.P., Chang, Y., Vogelman, J.H., Orentreich, N & Sibley, R.K (1991) Helicobacter pylori infection and the risk of gastric carcinoma N Engl J Med 325, 1127–1131 McGee, D.J & Mobley, H.L.T (1999) Mechanisms of Helicobacter pylori infection: bacterial factors In Current Topics in Microbiology and Immunology Gastroduodenal Disease and Helicobacter Pylori: Pathophysiology, Diagnosis and Treatment (Westblom, T.U., Czinn, S.J & Nedrud, J.G., eds) SpringerVerlag, Berlin Mobley, H.L.T (1997) Structure and function of Helicobacter pylori urease In Immunobiology of H pylori from Pathogenesis to Prevention (Ernst, P.B., Michetti, P & Smith, P.D., eds), pp 155–180 Lippinocott-Raven Publishers, New York Gobert, A.P., McGee, D.J., Akhtar, M., Mendz, G.L., Newton, J.C., Cheng, Y., Mobley, H.L.T & Wilson, K.T (2001) Helicobacter pylori arginase inhibits nitric oxide production by eukaryotic cells: a strategy for bacterial survival Proc Natl Acad Sci USA 98, 13844–13849 McGee, D.J., Radcliff, F.J., Mendz, G.L., Ferrero, R.L & Mobley, H.L.T (1999) Helicobacter pylori rocF is required for arginase activity and acid protection in vitro but is not essential for colonization of mice or for urease activity J.Bacteriol 181, 7314–7322 Krebs, H.A & Henseleit, K (1932) Untersuchungen uber die ă Harnstobildung im Tierkorper Z Physiol Chem 210, 3366 ă 10 Mendz, G.L & Hazell, S.L (1996) The urea cycle of Helicobacter pylori Microbiology 142, 2959–2967 11 Mendz, G.L., Holmes, E.M & Ferrero, R.L (1998) In situ characterisation of Helicobacter pylori arginase Biochim Biophys Acta 1338, 465477 ă 12 Kossel, A & Dakin, H.D (1904) Uber die arginase Z Physiol Chem 41, 321–331 13 Hellerman, L & Perkins, M.E (1935) Activation of enzymes III The role of metal ions in the activation of arginase The hydrolysis of arginine induced by certain metal ions with urease J Biol Chem 112, 175–194 14 Bach, S.J & Killip, J.D (1961) Studies on the purification and the kinetic properties of arginase from beef, sheep and horse liver Biochim Biophys Acta 47, 336–343 15 Brown, G.W (1966) Studies in comparative biochemistry and evolution I Avian liver arginase Arch Biochem Biophys 114, 184–194 16 Hirsch-Kolb, H., Heine, J.P., Kolb, H.J & Greenberg, D.M (1970) Comparative physical-chemical studies of mammalian arginases Comp Biochem Physiol 37, 345–359 17 Jenkinson, C.P., Grody, W.W & Cederbaum, S.D (1996) Comparative properties of arginases Comp Biochem Physiol 114B, 107–132 18 Kuhn, N.J., Ward, S., Piponski, M & Young, T.W (1995) Purification of human hepatic arginase and its manganese (II)dependent and pH-dependent interconversion between active and inactive forms: a possible pH-sensing function of the enzyme on the ornithine cycle Arch Biochem Biophys 320, 24–34 19 Mohamed, M.S & Greenberg, D.M (1945) Liver arginase I Preparation of extracts of high potency, chemical properties, activation-inhibition, and pH activity Arch Biochem Biophys 8, 349–364 ´ 20 Mora, J., Tarrab, R., Martuscelli, J & Soberon, G (1965) On the structure and function of different arginases Biochem J 96, 588–594 21 Reczkowski, R.S & Ash, D.E (1994) Rat liver arginase: kinetic mechanism, alternate substrates, and inhibitors Arch Biochem Biophys 312, 31–37 22 Greenberg, D.M., Bagot, A.E & Roholt, O.A (1956) Liver arginase III Properties of highly purified arginase Arch Biochem Biophys 62, 446–453 23 Mora, J., Tarrab, R & Bojalil, L.F (1966) On the structure and function of different arginases Biochim Biophys Acta 118, 206–209 24 Broman, K., Lauwers, N., Stalon, V & Wiame, J.-M (1978) Oxygen and nitrate in utilization by Bacillus licheniformis of the arginase and arginine deiminase routes of arginine catabolism and other factors affecting their syntheses J Bacteriol 135, 920–927 25 Ramaley, R.F & Bernlohr, R.W (1966) Postlogarithmic phase metabolism of sporulating microorganisms II The occurrence and partial purification of an arginase J Biol Chem 241, 620–623 26 Shimotohno, K.W., Iida, J., Takizawa, N., EndC, T (1994) ¸ Purification and characterization of arginine amidinohydrolase from Bacillus brevis TT02-8 Biosci Biotechnol Biochem 58, 1045–1049 27 Soru, E (1983) Chemical and immunological properties of Bacillus anthracis arginase and its metabolic involvement Mol Cell Biochem 50, 173–183 28 Wu, C.W., Chung, W.W., Chi, C.W., Kao, H.L., Lui, W.Y., Peng, F.K & Wang, S.R (1996) Immunohistochemical study of arginase in cancer of the stomach Virchows Arch 428, 325–331 29 Weeks, D.L., Eskandari, S., Scott, D.R & Sachs, G (2000) A H+-gated urea channel: the link between Helicobacter pylori urease and gastric colonization Science 287, 482–485 30 Wu, G & Morris, S.M (1998) Arginine metabolism: nitric oxide and beyond Biochem J 336, 1–17 31 Sambrook, J., Fritsch, E.F & Maniatis, T (1989) Molecular Cloning: a Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 32 Mobley, H.L.T., Island, M.D & Hausinger, R.P (1995) Molecular biology of microbial ureases Microbiol Rev 59, 451–480 33 McGee, D.J., May, C.A., Garner, R.M., Himpsl, J.M & Mobley, H.L.T (1999) Isolation of Helicobacter pylori genes that modulate urease activity J Bacteriol 181, 2477–2484 34 Mobley, H.L.T., Garner, R.M & Bauerfeind, P (1995) Helicobacter pylori nickel transport gene nixA: synthesis of catalytically active urease in Escherichia coli independent of growth conditions Mol Microbiol 16, 97–109 1962 D J McGee et al (Eur J Biochem 271) 35 Hu, L.-T., Foxall, P.A., Russell, R & Mobley, H.L.T (1992) Purification of recombinant Helicobacter pylori urease apoenzyme encoded by ureA and ureB Infect Immun 60, 2657–2666 36 Hu, L.-T & Mobley, H.L.T (1993) Expression of catalytically active recombinant Helicobacter pylori urease at wild-type levels in Escherchia coli Infect Immun 61, 2563–2569 37 Fulkerson, J.F Jr, Garner, R.M & Mobley, H.L.T (1998) Conserved residues and motifs in the NixA protein of Helicobacter pylori are critical for the high affinity transport for nickel ions J Biol Chem 273, 235–241 38 Szumanski, M.B.W & Boyle, S.M (1990) Analysis and sequence of the speB gene encoding agmatine ureohydrolase, a putrescine biosynthetic enzyme in Escherichia coli J Bacteriol 172, 538–547 39 Christianson, D.W (1997) Structural chemistry and biology of manganese metalloenzymes Prog Biophys Mol Biol 67, 217– 252 40 Kobayashi, M & Shimizu, S (1999) Cobalt proteins Eur J Biochem 261, 1–9 Ó FEBS 2004 41 Testerman, T.L., McGee, D.J & Mobley, H.L.T (2001) Helicobacter pylori growth and urease detection in the chemically defined medium Ham’s F-12 nutrient mixture J Clin Microbiol 39, 3842–3850 42 Seetharam, B., Bose, S & Li, N (1999) Cellular import of cobalamin (Vitamin B-12) J Nutr 129, 1761–1764 43 Annibale, B., Capurso, G & Delle Fave, G (2002) Consequences of Helicobacter pylori infection on the absorption of micronutrients Dig Liver Dis 34 (Suppl 2), S72–S77 44 Kaptan, K., Beyan, C., Ural, A.U., Cetin, T., Avcu, F., Gulsen, M., Finci, R & Yalcin, A (2000) Helicobacter pylori – is it a novel causative agent in vitamin B12 deciency? Arch Intern Med 160, 13491353 ă 45 Serin, E., Gumurdulu, Y., Ozer, B., Kayaselcuk, F., Yilmaz, U & ă ă ă ă Kocak, R (2002) Impact of Helicobacter pylori on the develop¸ ment of vitamin B12 deficiency in the absence of gastric atrophy Helicobacter 7, 337–341  ... sufficient for arginase activity, and that the enzyme has a number of interesting and unique features among the arginase superfamily, including optimal enzymatic activity with cobalt rather than manganese,... concentration of 0.20–0.25 mM), 50–100 pmol of each primer, and 2.5 U of thermostable DNA polymerase E coli was transformed by the calcium chloride method Construction of the arginase mutant of H pylori. .. After h the reaction was stopped by the addition of 750 lL of acetic acid, and the color developed by the addition of 250 lL of ninhydrin (4 mgỈmL)1) at 95 °C for h A standard curve of different