Agents associated with colorectal cancer 2

... those of subjects with polyps (22 /22 , 100%; Table 4.7) HRA1-positive bacteria were found to be more prevalent in subjects with polyps (p

Ngày tải lên: 11/09/2015, 16:08

... AE0002 01 246-266 AE0002 01 850-830 AE0002 01 114 3 -11 63 AE0002 01 1958 -19 38 AE0002 01 512 9- 514 8 AE0002 01 5750-57 31 AE0002 01 7 218 -7242 AE0002 01 77 61- 7737 AE0002 01 8332-8356 AE0002 01 88 91- 8867 AE0002 01 10574 -10 593 ... host cells 48 Table 3 .1 Primer Code ECM-246 ECM-850 ECM -11 63 ECM -19 58 torT- 512 9 torT-5750 torC-7 218 torC-77 61 torA-8332 torA-88 91 t...

Ngày tải lên: 11/09/2015, 16:08

... (58 .3% ) 5/15 (33 .3% ) 3/ 13 ( 23. 1%) CNF1 positive* 5/12 (41.7%) 2/15 ( 13. 3%) 3/ 13 ( 23. 1%) Tia positive* 1/12 (8 .3% ) 3/ 15 (20.0%) 2/ 13 (15.4%) HRA1 and Tia positive* 2/12 (16.6%) 2/15 ( 13. 3%) 1/ 13 ... (16.7%) 3/ 38 (7.9%) CNF1 positive* 3/ 36 (8 .3% ) 1 /38 (2.6%) Tia positive* 4 /36 (11.1%) 6 /38 (15.8%) 0 /36 (0%) 0 /38 (0%) 10 /36 (27.8%) 9 /38 ( 23. 7%) 3/ 36 (8...

Ngày tải lên: 11/09/2015, 16:08

... and CNF1 can be found in cancer cells but not in the majority of normal cells is much more informative than just knowing that E.coli ribosomal genes are associated with cancer [Swidsinski A et ... a high prevalence of HRA1-postivie E.coli among the cancer subjects and subjects with adenomas, when compared with normal subjects and those with hyperplasia Similar prevalence patte...

Ngày tải lên: 11/09/2015, 16:08

... is also associated with oral and other anogenital malignancies, however, it is most commonly associated with cervical cancer; in fact, over 99% of all cervical cancers are associated with high-risk ... virus (JCV) (brain cancer) [42], (reviewed in [41]); (iv) human endogenous retroviruses (HERVs) (germ cell tumors, breast cancer, ovarian Although retroviruses have been assoc...

Ngày tải lên: 15/02/2014, 05:20

... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... changes that characterize prostate cancer progression Cancer Res 2001, 61:2212-2219 Sakakura C, Hagiwara A, Yasuoka R, Fujita Y, Nakanishi M, Masuda K, Shimomura K, Nakamura Y, Ina...

Ngày tải lên: 18/06/2014, 19:20

... investigation of dispositional optimism as a predictor of health-related quality of life in head and neck cancer patients Qual Life Res 2000, 9:951-960 Schultz AA, Winstead-Fry P: Predictors of quality of ... these two predictors The measures of perceived quality of care (problems with Treatment Information, control of pain/discomfort, control of nausea...

Ngày tải lên: 18/06/2014, 19:20

... invasion, metastasis, and prognosis Lung Cancer 2002, 36:115-124 doi:10.1186/1479-5876-9-100 Cite this article as: Lo Iacono et al.: Aurora Kinase A expression is associated with lung cancer histological-subtypes ... data interpretation and drafted the manuscript MP and GVS participated in study design and coordination, data analysis and interpretation and...

Ngày tải lên: 20/06/2014, 04:20

... and FACT-C quality of life questionnaires in patients with colorectal cancer Health and Quality of Life Outcomes 2011 9:70 Submit your next manuscript to BioMed Central and take full advantage of: ... construction and testing of the EORTC colorectal cancer-specific quality of life questionnaire module (QLQ-CR38) European Organization for Research...

Ngày tải lên: 20/06/2014, 15:20

... risk for lung cancer (HR, 1.70) than men with 25 to 32 teeth Although periodontal disease was associated with significant increases in total (HR, 1.21) and hematological (HR, 1.35) cancers in men ... the risk for total cancer was seen in men who reported having periodontal disease, compared with those who did not, the authors note "The increase in risk persisted in ne...

Ngày tải lên: 29/07/2014, 02:21

... Rothfuss S, et al.: Surveying for evidence of synovial Chlamydia trachomatis by polymerase chain reaction (PCR) A study of 411 synovial biopsies and synovial fluids Arthritis Rheum 1997, 40:S270 ... Presumably, they are controlled by innate immune mechanisms, including macrophages and polymorphs; indeed, it is likely that many of the organisms detected were engulfed by phagocyte...

Ngày tải lên: 09/08/2014, 01:21

... and intra-abdominal organs Situs inversus is a rare congenital deformity and is classified as either situs inversus totalis (SIT) or partial situs inversus Unlike partial situs inversus, in cases ... Double primary malignancies associated with colon Cancer in patients with Situs Inversus Totalis: Two Case Reports Young Wan Kim1, Hoon Ryu1, Dae Sung...

Ngày tải lên: 09/08/2014, 02:21

... al.: Young patients with colorectal cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic ... colorectal cancer was greatest in the first 20 months after operation Contrary to some previous reports, survival beyond tw...

Ngày tải lên: 09/08/2014, 03:22

... percent of CRC patients having synchronous appendiceal neoplasm [7] Given the difficulty in diagnosis of appendiceal tumors and the certain risk of synchronous and metachronous neoplasm of the ... difficulty in diagnosis of appendiceal tumors and the certain risk of synchronous and metachronous neoplasm of the appendix [5,7] Little is known about...

Ngày tải lên: 09/08/2014, 04:21

... with beads with liver dominant hepatic metastasis after ingDisease Free Survival failing standardSurvival ofIrinotecan drug elutingIrinotecan drug eluting beads with liver dominant faila) standard ... spleen, and lung Treatment was delivered to the right lobe and consisted of vials of DEBIRI loaded with 200 mg of Irinotecan One vial contained beads measuring 300-...

Ngày tải lên: 09/08/2014, 04:21