Immunomodulatory properties of polysaccharide protein comple

Immunomodulatory properties of polysaccharide protein complex from lycium barbarum l

... NH2-terminal kinase kDa kilo Dalton L liter L barbarum Lycium barbarum L LAK cell lymphokine-activated killer cell LAL Limulus amebocytes lysate LbGp L barbarum glycoconjugates LBP Lycium barbarum polysaccharide- protein ... polysaccharide- protein complex LBPF Lycium barbarum polysaccharide- protein complex fraction LC Langerhans cell LDH lactate dehydrog...

Ngày tải lên : 11/09/2015, 16:03

208
183
0

Báo cáo khóa học: Functional properties of the protein disulﬁde oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulﬁde-isomerase doc

... tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex aeolicus; Tt, Thermoanaerobacter tengcongensis ... presence of unlabeled ATP, indicating that ATP and the analog 8-azido-ATP recognize the same binding site The ATPase activity of PfPDO was demonstrated The hydrolysis of ATP...

Ngày tải lên : 16/03/2014, 16:20

12
506
0

Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx

... UV-VIS and FT-IR spectroscopic properties of the caa 3oxidase from T thermophilus in the presence and absence of cyanide, and compare the observed properties to previous reports on members of the heme ... between cytochrome c and cytochrome c oxidase Previous reports on the caa3- oxidase from T thermophilus concluded that this enzyme is a typical...

Ngày tải lên : 21/02/2014, 15:20

9
528
0

Báo cáo khoa học: Protein folding intermediates of invasin protein IbeA from Escherichia coli pdf

... available on protein folding intermediates [11–18], there are no reports available for E coli invasin protein IbeA The process of unfolding and refolding is useful for a complex unfolding transition, ... spectroscopic techniques to identify protein folding intermediates Protein folding intermediates Puriﬁcation of IbeA The expression level of IbeA was 6–8 m...

Ngày tải lên : 07/03/2014, 05:20

12
335
0

Báo cáo khóa học: Structural properties of the protein SV-IV potx

... a-helix in the whole protein, and the 1–70 region is poorly structured SDS increases the a-helix content of proteins revealing the helical potential The a-helix content of the monomeric form of SV-IV ... acetylation at one of the three residues, because the signal of the triacetylated species was less intense than that of the diacetylated species The MS/MS...

Ngày tải lên : 07/03/2014, 14:20

9
416
0

Báo cáo khóa học: Localization, puriﬁcation and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot

... These data indicated that the fractionation procedure was satisfactory and that the tetrathionate hydrolase is a periplasmic enzyme Puriﬁcation of the tetrathionate hydrolase from tetrathionate- grown ... properties of tetrathionate hydrolase of A caldus were similar to those of other acidithiobacilli (Table 4) The speciﬁc activity of tetrathionate hydr...

Ngày tải lên : 07/03/2014, 14:20

9
609
0

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... of parallel b strands associated to an antiparallel strand (b2) and is surrounded by helices (a1 , a2 , a3 , a7 and a8 ) The second domain consists of helices a4 , a5 and a6 all clustered on the top ... indicating that Rv1399c is composed of 22% of a- helices, 25% of b-strand and 39% of random coil The catalytic triad is located at the bottom of a s...

Ngày tải lên : 07/03/2014, 16:20

9
584
0

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

... resistant to cleavage with chymotrypsin, trypsin, papain, or pronase Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells, and the Giardia protease is the ... expressed at a high level (data not shown) DISCUSSION Computer analysis of b-expansins reveals signiﬁcant similarity to cathepsins, which are members of the C1 fami...

Ngày tải lên : 08/03/2014, 22:20

10
535
0

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate speciﬁcity doc

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for cataly...

Ngày tải lên : 16/03/2014, 00:20

9
491
0

Báo cáo khoa học: Structural characterization of photosystem II complex from red alga Porphyridium cruentum retaining extrinsic subunits of the oxygen-evolving complex docx

... PSII essentially independent on the presence of other extrinsic proteins [44], whereas effective binding of red algal cyt c550 to the red algal PSII requires the presence of all of the other extrinsic ... occurrence of the free CP43 subunit in the fraction A of the sucrose gradient (Fig 1B, lane A) The absence of other peripheral densities in the top-vi...

Ngày tải lên : 16/03/2014, 18:20

9
426
0

Báo cáo khoa học: Isolation and structural characterization of the Ndh complex from mesophyll and bundle sheath chloroplasts of Zea mays pptx

... for the Ndh membrane subcomplex The Ndh antibodies recognized the 46, 28, 18 and 12 kDa polypeptides, corresponding to the NdhH, -K, -J and -E subunits of the Ndh complex The intact Ndh complex, ... et al of the ndh genes is much higher in BS chloroplasts, and elevated amounts of the Ndh complex have been found in these plastids [18] The functio...

Ngày tải lên : 23/03/2014, 13:20

12
431
0

Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

... 498 nm bands and the shift of the band at 630 nm to the longer-wavelength direction At the same time, a broad band with the maximum at approximately 690 nm appears and increases with time The newly ... nm-band of NADPH decreases in proportion to the decrease of Soret band at 410 nm and to the increases of broad band spreading 600–700 nm The latter band was...

Ngày tải lên : 23/03/2014, 20:22

12
459
0

Structural characterization and study of immunoenhancing properties of a glucan isolated from a hybrid mushroom of Pleurotus florida and Lentinula edodes pot

... H-2 Atom Structural characterization and study of immunoenhancing properties of a glucan isolated from a hybrid mushroom of Pleurotus florida and Lentinula edodes Praloy K Majia, Ipsita K Sena, ... 64 65 Structural characterization and study of immunoenhancing properties of a glucan isolated from a hybrid mushroom of P...

Ngày tải lên : 28/06/2014, 11:20

26
358
0

Structural characterization and study of immunoenhancing properties of a glucan isolated from a hybrid mushroom of Pleurotus florida and Lentinula edodes potx

... H-2 Atom Structural characterization and study of immunoenhancing properties of a glucan isolated from a hybrid mushroom of Pleurotus florida and Lentinula edodes Praloy K Majia, Ipsita K Sena, ... 64 65 Structural characterization and study of immunoenhancing properties of a glucan isolated from a hybrid mushroom of P...

Ngày tải lên : 28/06/2014, 11:20

26
291
0

Báo cáo khoa học " In vitro cytostatic and immunomodulatory properties of the medicinal mushroom Lentinula edodes " pdf

... the following reasons: The production of fruit bodies and mycelium in L edodes as well as in many other medicinal mushrooms, comprise the two main production methods (Wasser and Weis, 1999) The ... and methods The strain of L edodes (Berk.) Pegler used in this study, was originated from China and registered in the fungal culture collection of the Edib...

Ngày tải lên : 28/06/2014, 11:20

8
383
0