Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives

... sources, named embryonic stem cells Literature review (ESCs), embryonic germ cells, fetal stem cells, umbilical cord stem cells, adult stem cells and induced pluripotent stem (iPS) cells (Ariff ... cell source for future clinical applications Literature review Table Characterization of stem cells by derivation source Category Embryonic stem cells Embryonic germ cells Fetal stem cells Umbilical ... Xiao R, and Cao T Establishment of Autologous Feeders for Human Embryonic Stem Cells Propagation 2nd Meeting of IADR Pan Asian Pacific Federation (PAPF) and the 1st Meeting of IADR Asia/Pacific...

... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... GACCTCCACAGTTGTAGCAA 3’ TRCN 0000102579 LIN28sh2F 5’ CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCACTTACAGATGA ... TGGGCATCAGGCCAAGTC TGCAGGTCCCTTGGACATG TGGCGCCGGTTACAGAAC AAGCTGTATATTTACTCATTGAAA CAC GCCATCATCATTACCCATTGC GCCCAATACGACCAAATCC ACCCGTGGTCACCATGGTA Chapter Results 3.1 SAGE data analysis to search...

... adult stem cells is their inability to effectively grow in Human embryonic stem cells and therapeutic cloning culture Therefore, obtaining clinically significant amounts of adult stem cells may ... and characterization of human embryonic stem cells Stem Cells Dev 2004, 13, 325-336 18 Drukker M, Benvenisty N The immunogenicity of human embryonic stem- derived cells Trends Biotechnol 2004, ... transplantation, embryonic stem cells, and the potential for cell therapy N Eng J Med 2003, 349, 275-286 27 Hogan B, Beddington R, Costantini F, Lacy E Isolation, culture and manipulation of embryonic stem cells...

... progression in the progenitors and reduces the generation of MbDNs in vMb Interestingly, further insights into the role of Wnt1/β-catenin pathway revealed that it is also required to maintain the integrity ... changes in the concentration or the duration of Shh have an effect on intracellular signaling in the spinal cord 23 Aim of the study Aim of the thesis MbDNs play pivotal roles in the regulation of ... vMb neurons, including the neurons in the oculomotor nucleus (OM) and 19 Introduction the non-MbDNs in the SNr (Figure 7) These data further support the idea that there are distinct subsets of...

... transplanted vascular cells derived from human ES cells and the vascular density in the infarct area after the transplantation In the saline- and hMNCs-injected groups, the vascular density of host ... characterization of transplanted cells derived from human ES cells We induced differentiation of human ES cells in an in vitro two-dimensional culture on OP9 stromal cell line and examined the expression of ... The findings reported here demonstrate that the transplantation of vascular cells, ECs and MCs derived from human ES cells, to the ischemic brain significantly promoted vascular regeneration in...

... family, the miR-200 family have been reported in human [16,17] and mouse embryonic stem cells [18-20] The unique patterns of miRNA expression in embryonic stem cells suggest they are involved in maintaining ... instance, miR-373 induces the expression of E-cadherin and CSDC2 by targeting their promoter region and initiate their expression[ 73] Another mechanism is that the engagement of miRNA and their targets ... names of human embryonic stem (hES) cells lines P denoted the number of passages of the cell lines H9-EB denoted embryoid body (EB) prepared from cell line H9 and the day indicates the time in culture...

... specification of midbrain dopamine neurons Radial glia cells are neuronal progenitors in vivo 10 11 14 1. 3 Long non- coding RNAs in biology 15 1. 3 .1 1.3.2 1. 3.2 .1 1.3.2.2 1. 3.2.3 Long non- coding RNAs in pluripotency ... pluripotency, and repressing differentiation simultaneously   18   1. 3.2 Long non- coding RNAs in neural development Long non- coding RNAs are abundant in the brain, and a study scrutinizing in situ hybridization ... Long non- coding RNAs in neural development Nkx2.2AS Evf2 Malat1 16 19 19 20 20 1. 4 Molecular mechanisms of long non- coding RNA function 21 1.4 .1 LncRNAs behave as scaffolds that target protein...

...

... chr 13: 36 ,31 5,670 -36 ,31 7,9 83 chr4:1,179,572-1,181,6 03 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 AK124684 AK125262 AK12 539 2 AL 832 189 AY927 532 BC008027 BC 030 122 BC 031 955 ... location (NCBI36/hg18) AF242771 AK05 533 5 AK056826 (lncRNA_ES1) AK0911 13 AL117559 AL 833 138 BC02 630 0 (lncRNA_ES3) chr12: 63, 376, 238 - 63, 376,597 chr19: 43, 012, 031 - 43, 014, 637 chr3:171,595,099-171,597 ,31 2 chr5:67,124,797-67, 132 ,641 ... AK12 539 2 AL 832 189 BC008027 BC 030 122 BC 031 955 BC 033 371 BC 035 156 BC 036 480 BC 038 536 BC041400 BC041859 BC042044 BC0 432 37 BC0 432 54 BC0 433 80 BX649145 L31955 chr8:110,725,520-110,729,489 chr 13: 36 ,31 5,670 -36 ,31 7,983...

... was confirmed by qPCR in two independent cell lines: hESC (H1)-derived NPCs and an immortalized human neural stem cell line ReN-VM In both hESC-derived cells and ReN-VM cells, RMST expression ... silencing factor, is a transcription factor expressed in neural stem cells and non- neuronal cells, to repress neuronal gene expression To confirm that REST indeed binds upstream of RMST in the neural ... chromatin binding Quantitative PCR of the ChIP DNA revealed REST occupancy at the region upstream of RMST (pRMST), confirming that REST binds upstream of RMST in the human neural stem cell line (Figure...

... established in the mouse model system, and very few human lncRNAs have been studied with such extent In this thesis, I focused on examining lncRNAs involved in the pluripotency maintenance of human embryonic ... B., Liu, M., and Shi, T (2011) Comparative analysis of human protein -coding and noncoding RNAs between brain and 10 mixed cell lines by RNA-Seq PLoS One 6, e28318 Chen, M., Zhang, J., and Manley, ... Amable, R., and Freed, W.J (2008) Assessment of stromal-derived inducing activity in the generation of dopaminergic neurons from human embryonic stem cells Stem Cells 26, 151 7- 152 5 Walker, E.,...

... staining (c) hFOB H & E staining (d) hFOB von Kossa staining Scaffold (e) hFOB H & E staining Figure At 2-week time point: H&E staining and von Kossa staining of sections showing scaffold and cells ... time point: H&E staining and von Kossa staining of sections showing scaffolds devoid of cells 43 Figure At week time-point: (a) H&E staining showing newly formed tissue within the ... understanding of the mechanism underlying the lineage specific differentiation of hES cells is mandatory 1.5 Human Embryonic stem cells As the name suggests, the human embryonic stem cells are...

... JM Embryonic stem cell lines derived from human blastocysts Science 1998;282(5391):1145-7 Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A Embryonic stem cell lines from human blastocysts: ... Germany) with an HBO-103 mercury lamp and filter sets for FITC, Cy3.5, Texas Red, Cy5, Aqua, and DAPI Images were captured, processed, and analyzed using ISIS mBAND/mFISH imaging software (MetaSystems ... mammalian embryos and oocytes rapidly lose their viability even upon relatively short durations of exposure to low temperature [15, 16] Although later stage pre-implantation embryos of mice (8-cell and...