Growth morphology of a glycine crystals in solutions an extended interface structure analysis 1
... glycine crystals in aqueous solutions predicted from simulations (Gnanasambandam and Rajagopalan 2 010 ; Gnanasambandam and Rajagopalan 2 010 (Accepted for publication)) and (B) Morphology of glycine ... Gnanasambandam, S and R Rajagopalan (2 010 ) "Growth Morphology of α -Glycine Crystals in Solution Environments: An Extended Interface Structure Analysis" Cry...
Ngày tải lên: 11/09/2015, 10:05
... morphologies in solutions: (A) Morphology of glycine crystals in aqueous solutions predicted from simulations (Gnanasambandam and Rajagopalan 20 10; Gnanasambandam and Rajagopalan 20 10 (Accepted for ... quantitative analysis of the solution structure at the interface is needed to establish the available growth units and the relative growth rates at each of the...
Ngày tải lên: 11/09/2015, 10:05
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo sinh học: " Identification of a major gene in F and F data when alleles 1 2 assumed fixed in the parental lines" pps
... considering a the type I error rate as irrelevant When the variance in F increased when in fact no major gene was present, a major gene was found in 10 0% of the cases For smaller increases of the variance ... given major gene variance of 50 When using only F data, the test had a power of only 12 % for detection of an additive effect of...
Ngày tải lên: 14/08/2014, 20:20
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
... precision of therapy like the intensity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain ... 14 It was used to investigate whether an intracellular MR imaging is possible and to estimate the T1 relaxivity on MR (1.5 T) Historically already in 1994 electron-spin-resonance...
Ngày tải lên: 26/10/2012, 09:07
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal
... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attr...
Ngày tải lên: 05/09/2013, 14:59
Sensor-based navigation of a mobile robot in an indoor environment
... obtained after including the unknown obstacle in the data base and starting again the planning [15] In fact the main penalization due to unknown obstacles is the decreasing of the linear speed of ... to the actual characteristics of the robot This means that the rough and manual tuning of the parameters of the fuzzy controller is replaced by a fine local automatic tuning and...
Ngày tải lên: 23/10/2013, 15:15
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf
... R, Qiao C & Mulchandani A (2010) Cotranslocation of methyl parathion hydrolase to the periplasm and of organophosphorus hydrolase to the cell surface of Escherichia coli by the Tat pathway and ... least three replicates The Km and kcat values were calculated by nonlinear regression using graphpad prism 5.0 (GraphPad Software Inc., La Jolla, CA, USA) Thermostability a...
Ngày tải lên: 15/02/2014, 01:20
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... instead of the SecB pathway could be explained by the increased hydrophobicity of the hydrophobic core of the mutant signal sequence, because hydrophobicity was previously reported to be an important ... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo "The linguitic Situation of a Hmong Community in the North - West of Vietnam " pdf
Ngày tải lên: 12/03/2014, 00:21
The Project Gutenberg EBook of A First Book in Algebra, pot
... − 7a − 3a From take 2a 5a − 3a To add 2a − 5a − 3a From take − 4a To − 4a − 3a add 3a a a The principle is clear; namely, The subtraction of any number gives the same result as the addition of that number ... remain in the tank at the end of five days? 18 Two men are 150 miles apart, and approach each other, one at the rate of x miles an hour, the other...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... in ltrated zones at the indicated time points (Fig 1D) The extent of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after A...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt
... the interaction of PCPs with membranes was predominantly in uenced by initial electrostatic interactions, whereas the interaction of PFPs with membranes was most affected by hydrophobic interactions ... other Central proline in amphipathic a- helix amphipathic a- helical peptides such as magainin [52,53], the initial binding of M17P (K1 ¼ 6.8 · 104 m)1) was much f...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na...
Ngày tải lên: 28/03/2014, 23:20