Functional analysis of human nima related kinase 8 (nek8)

... FUNCTIONAL ANALYSIS OF HUMAN NIMA- RELATED KINASE (Nek8) LIU JUN (B Sc.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE ... SUMMARY As a member of NIMA- related kinase family (Nrk), Nek8 has an N-terminal serine/threonine kinase domain highly homologous with that of NIMA Most o...

Ngày tải lên: 11/09/2015, 10:03

... al.: Genome-wide functional analysis of human 5’ untranslated region introns Genome Biology 2010 11:R29 Submit your next manuscript to BioMed Central and take full advantage of: • Convenient ... variability in expression, they are removed from further analysis (b) Boxplot of the coefficient of variation (standard deviation-to-mean ratio) of genes grouped by the total...

Ngày tải lên: 09/08/2014, 20:21

... not identical transactivation phenotypes in Tax 2B Results Transactivation phenotypes of Tax 2A Lor and Gar In the present study we examined the transactivation phenotypes of two Tax 2A proteins ... citation purposes) Retrovirology 20 06, 3 :20 http://www.retrovirology.com/content/3/1 /20 Table 3: Transactivation phenotypes of Tax 2A Mo and Tax mutants Table 4: Transactivatio...

Ngày tải lên: 13/08/2014, 09:21

... activity between the three human clones and the three chimpanzee clones analyzed To estimate what fraction of mRNAs differently expressed between human and chimpanzee tissues may be caused by DNA ... basis of the availability of an annotated transcription start site [28], the availability of human and chimpanzee DNA sequence of high quality, the possibility to plac...

Ngày tải lên: 14/08/2014, 14:21

... group of GHMP kinases in which proton transfer does not play a major role in the rate determining step of catalysis That five of the 10 disease-causing mutations resulted in insoluble protein in ... play a major role in the rate-determining step of catalysis Several of the disease-causing mutations are not soluble following induction in E coli Although all the mut...

Ngày tải lên: 08/03/2014, 02:20

... selective ligands BQ -12 3 and [Ala1,3 ,11 ,15 ]ET -1 Biochem Biophys Res Commun 18 2, 14 4 15 0 40 Saeki T, Ihara M, Fukuroda T, Yamagiwa M & Yano M (19 91) [Ala1,3 ,11 ,15 ]Endothelin-< /b> 1 analogs with ETB agonistic ... 3266 Ligand -binding analysis < /b> The Cy3 dye was attached at Lys9 of < /b> cET -1 Biotin was covalently attached to Cys1 of < /b> ET -1 and Lys-9, resu...

Ngày tải lên: 16/03/2014, 10:20

... Timson Disease-causing mutations in human GALE Fig Crosslinking of wild-type and disease-causing mutants of UDP-galactose 4-epimerase (GALE) Crosslinking was carried out with N-(3dimethylaminopropyl)-N¢-ethylcarbodiimide ... during purification Kinetic analysis of disease-causing mutations The steady-state kinetic parameters of each of the nine disease-causing m...

Ngày tải lên: 23/03/2014, 11:20

... functional similarity of 29 viral miRNAs as illustrated in Figure The functional similarity matrix of the pairwise viral miRNAs was then analyzed by R package pvclust to assess the uncertainty of clustering ... as: Yu and He: Functional similarity analysis of human virus-encoded miRNAs Journal of Clinical Bioinformatics 2011 1:15 Submit your next manuscript to BioMed Centr...

Ngày tải lên: 10/08/2014, 09:22

... In this study we compare the proteomes of mDCs, moDCs and KG-1 cells, and then attempt to relate this to the functional properties of these cells Figure shows the workflow and the way in which ... pooled and a cytokine bead array (CBA; Inflammation kit, Becton Dickinson) was performed in triplicate Endocytosis assay For the analysis of the endocytic activi...

Ngày tải lên: 14/08/2014, 18:20

... unaffected in the mRNA degradation mutants PAGE-northern analyses of piRNA production in the mRNA degradation mutants The level of piRNA production is unaffected in the mRNA degradation mutants ... 3’-UTR, and poly (A) All examined regions are derepressed in dcp1 and ski3 mutants (b) Quantitative RACE-PAT and RT-PCR of HeT -A mRNA, normalised against act5C, in dcp1 an...

Ngày tải lên: 14/09/2015, 08:25

... 40 The homologous domains with Syp1p through searching against database - 89 x Abbreviations a. a or aa amino acid AAK1 adaptor-associated kinase ADF actin depolymerizing factor ADFH actin ... FUNCTIONAL ANALYSIS OF SYP1, A NOVEL SUBSTRATE OF THE SERINE/ THREONINE KINASE PRK1 QIU WENJIE A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY INSTITUTE...

Ngày tải lên: 14/09/2015, 11:59

... assay as a marker of classification of RNA- positive reticulocytes and erythrocytes 10, 11, 12 or by attempts to describe of human erythroid gene activity, planed to be finished in 5-10 years ... human RBCs The purity of erythrocyte fraction achieved 99,99997% and was confirmed by Pappenheim staining of blood slides, flow cytometry (MÖLAB, Germany) and FACS analysis (Cytomic...

Ngày tải lên: 03/11/2012, 10:58

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at fou...

Ngày tải lên: 18/02/2014, 16:20

... activity of DEC1 is also required for the interaction with BMAL1 Binding of DEC1 mutants to a CACGTG E-box To examine the binding ability of DEC1 mutants to the CACGTG E-box in the Dec1 promoter, ... for DEC1 suppressive activity against CLOCK/BMAL1-induced transcription In addition, the N-terminal region of DEC1, including the bHLH domain, interacted with...

Ngày tải lên: 19/02/2014, 16:20

... blocked the 3889 Mapping of transcobalamin using antibodies S N Fedosov et al Table Specicity of monoclonal anti- (human transcobalamin) sera and their effect on the functional properties of transcobalamin ... effect of some mAbs on the functional properties of TC (this study, [16]) supplemented the epitope mapping and provided a deeper insight into opera...

Ngày tải lên: 20/02/2014, 01:20