Reducing pathological accumulations of phosphorylated neurofilament h through modulation of pin1 activity implications in amyotrophic lateral sclerosis

... S phase (Ekholm-Reed et al., 2004) Pin1 regulates the turnover of Cyclin E, where Pin1- /MEF showed higher levels of Cyclin E resulting in the impairment of the progression through the G1-S phase ... to inhibit or increase the activity of Cdc25, which is the activating phosphatase of the Cdc2-Cyclin B complex that is required for the entry into the mitotic phase depending o...

Ngày tải lên: 10/09/2015, 09:29

... same mouse; and (b) the protein was consistently identified in the independent Fig Evaluation of the isolation of lipid raft proteins Lipid raft proteins were isolated from spinal cords of symptomatic ... Metabolism AATM _MOUSE CHP1 _MOUSE CD81 _MOUSE CDC42 _MOUSE CAH2 _MOUSE DHPR _MOUSE ALDOC _MOUSE LDHB _MOUSE MDHM _MOUSE MBP _MOUSE MYP0 _MOUSE SIRT2 _MOUSE...

Ngày tải lên: 23/03/2014, 04:21

... play a primary role in the differing toxicity of G93ASOD1 and wtSOD1 As long as GCL activity and GCLM are elevated, as in lowG9 3A- tTA cells, motor neuronal cells maintain some antioxidant capacity ... Our model appears to also provide a tool to investigate the effects of chronic exposure to a small amount of G93ASOD1, as seen in the motor neurons of F...

Ngày tải lên: 29/03/2014, 23:20

... this article as: Presseau et al.: Goal conflict, goal facilitation, and health professionals’ provision of physical activity advice in primary care: An exploratory prospective study Implementation ... We hypothesised that goal facilitation and goal conflict would predict health professional behaviour over and above intention and PBC Page of gi...

Ngày tải lên: 10/08/2014, 11:20

... Rison and Beydoun: Amyotrophic lateral sclerosismotor neuron disease, monoclonal gammopathy, hyperparathyroidism, and B12 deficiency: case report and review of the literature Journal of Medical Case ... Among these patients, few had a beneficial neurological response to immunotherapy, and most died of the neurological disease Other reports highlight...

Ngày tải lên: 11/08/2014, 02:21

... Mitochondrial dysfunction and mitophagy activation in blood mononuclear cells of fibromyalgia patients: implications in the pathogenesis of the disease Arthritis Research & Therapy 2010, 12:R17 Page 11 of ... hypothesis, showing the presence of mitophagy in BMCs of FM patients Autophagy is a regulated lysosomal pathway involved in the degradat...

Ngày tải lên: 12/08/2014, 11:22

... present analyses, accelerometer-based total physical activity (= light-intensity physical activity + moderate-intensity physical activity + vigorous-intensity physical activity) was used as outcome ... day, accelerometer-based total physical activity, and selfreported active transportation, physical activity for housekeeping and gardening, leisure-time physical acti...

Ngày tải lên: 14/08/2014, 08:20

... however is in agreement in both studies; the decrease of inosine in our study (Table 3) and the decline in the levels of metabolites of xanthine metabolism in the clinical study [80] point to a ... Logroscino, G., et al., Incidence of amyotrophic lateral sclerosis in Europe J Neurol Neurosurg Psychiatry, 2010 81(4): p 385-90 Marin, B., et al., Incidence of amy...

Ngày tải lên: 30/09/2015, 10:12

... STRUCTURE < /b> AND FUNCTION < /b> STUDIES < /b> OF < /b> VESICLE-< /b> ASSOCIATED < /b> MEMBRANE < /b> PROTEIN < /b> -ASSOCIATED < /b> PROTEIN < /b> B ASSOCIATED < /b> WITH AMYOTROPHIC LATERAL SCLEROSIS Lua Shixiong B. Sc (Hons.), NUS A THESIS SUBMITTED ... VAMP -associated < /b> protein < /b> VAPA /B/ C VAMP -associated < /b> protein < /b> A /B/ C VAPB-2 VAMP -ass...

Ngày tải lên: 12/10/2015, 17:34

... boundary in studying cultural words in the book “Wandering through Vietnamese culture” by Huu Ngoc It will look into the equivalence and non -equivalence of Vietnamese cultural words and their translations ... in the translation of cultural words • The main method is contrastive analysis • Data collection: The Vietnamese cultural...

Ngày tải lên: 07/11/2012, 14:31

... ACTION PLAN MAKING A CHART OF THE ENERGY CONSUMPTION IN H.C.M CITY INTRODUCTION OF GOAL • In new basic program of English 11.Unit 11 “sources of energy Part D writing: describing information ... has to take part in their work going to each of the family in their neighbour to take the notes of the amount of energy they spent (water, electricity, ,oi...

Ngày tải lên: 22/07/2013, 01:27

... of class of words denoting parts of human body in English and VietNamese on semantic transference 2.1 The origin of names referring to parts of the human body According to the aspect of origin, ... features - The amount of meanings In English, there are 82 words having primary meaning referring to parts of the human body possess...

Ngày tải lên: 18/12/2013, 21:45

... society and the private sector with key economic insights needed to help reduce the growing burden of NCDs: • A global analysis of the economic impact of NCDs by the World Economic Forum and the ... disease type and by country income category) The total burden is lowest in the low-income countries, in part because the value of lost earnings in...

Ngày tải lên: 20/02/2014, 19:20

... well as NO production Accordingly, we concluded that the enhancing effect of TS on LPS/IFN -induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives ... amphiphilic structure of the polar carboxyl moiety and the hydrophobic isoprene moiety The enhancing effect of TS on LPS/IFN -induced NO production was inh...

Ngày tải lên: 22/02/2014, 04:20

... AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] [58] [68] [69] [70] [71] FEBS Journal 272 (2005) 4754–47 73 ª 2005 FEBS 4765 Effect of ... (5¢-dACCGGAGAGGATATTTAGGCTGGGGCA TTGAAGGTTG -3 ; sense primer) vs Kin251 (5¢-dCAA CCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT -3 ; antisense primer) to generate pGL3b:Prm3abPPARc(a)* Mutation of the...

Ngày tải lên: 07/03/2014, 21:20