EXPLORATION OF PEROXISOME PROLIFERATOR ACTIVATED RECEPTOR GAMMA AGONIST IN ALZHEIMERS DISEASETHERAPY a THERAPEUTIC ENIGMA
... Laboratory Animal Research (Singapore) National Institute of Standards and Technology Nuclear magnetic resonance Orthogonal partial least squares discriminant analysis Principal component analysis ... tomography PPARγ coactivator 1α P-glycoprotein Pioglitazone Partial least squares discriminant analysis Peroxisome proliferator- activated receptor Peroxisome proliferator- activate...
Ngày tải lên: 09/09/2015, 11:20
... TNF-α, forward 5'-GCCTCTTCTCATTCCTGCTT-3', reverse 5'-CACTTGGTGGTTTGCTACGA-3'; for IL-1β, forward 5'CCCAAGCAATACCCAAAGAA-3', reverse 5'-CATCAGAGGCAAGGAGGAAA-3'; for monocyte chemoattractant protein-1 ... (MCP-1), forward 5'-AGCCAGATGCAGTTAACGC-3', reverse 5'-CTGATCTCATTTGGTTCGGA-3'; for RANKL, forward 5'-GCTCCGAGCTGGTGAAGAAAT-3', reverse 5'CCCAAAGTACGTCGCATCTTG-3' Osteoclast differentiation a...
Ngày tải lên: 09/08/2014, 07:20
... Regulation of < /b> PPARb turnover specific antibody because none of < /b> the < /b> available PPARb-specific antibodies are suitable for a quantifiable detection of < /b> PPARb at low expression < /b> levels In these experiments, ... protein level < /b> influence the < /b> degree of < /b> high Mr complex < /b> formation < /b> To investigate the < /b> nature of < /b> the < /b> high M...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: Visfatin is induced by peroxisome proliferator-activated receptor gamma in human macrophages pdf
... A *** *** Visfatin/ cyclophilin mRNA Control GW1929 RSG Visfatin/ cyclophilin mRNA Visfatin/ cyclophilin mRNA Visfatin/ cyclophilin mRNA A gene [23], was also induced to a similar extent in a dose-dependent ... PPARc-regulated gene in human macrophages Interestingly, PPARc activation enhanced visfatin gene expression in both M1 and M2 human macrophages, but not in murin...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: "Phenotype of peroxisome proliferator-activated receptor-α(PPARα)deficient mice on mixed background fed high fat diet" doc
... aP
Ngày tải lên: 07/08/2014, 17:22
Báo cáo khoa học: "Transactivation of peroxisome proliferator-activated receptor alpha by green tea extracts" docx
... proliferation by green tea extract is considered to be mediated through the activation of PPARα Generally, black tea is derived as a result of full fermentation of the leaves of green tea The concentration ... concentration of EGCG in oolong tea falls between that of green tea and black tea [19] However, the transactivation expressed by oolong tea was less...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo y học: "Retinoid X receptor and peroxisome proliferator-activated receptor-gamma agonists cooperate to inhibit matrix metalloproteinase gene expression" potx
... retinoic acid receptors, thyroid receptor, vitamin D receptor, PPARs, liver X receptors (LXRs), and farnesoid X receptor (FXR) [22], the ligand LG268 activates only a subset of the RXR catalog of ... structure and in the signaling pathways required for their expression may make it possible to target certain family members with specific ligands Peroxisome proliferator-activate...
Ngày tải lên: 09/08/2014, 13:22
báo cáo khoa học: " Increased hepatic oxidative metabolism distinguishes the action of Peroxisome proliferator-activated receptor d from Peroxisome proliferatoractivated receptor g in the ob/ob mouse" ppt
... studies, and drafted the manuscript DGH and DWA coordinated the animal study and sample collection JNH participated in intellectual discussion of the data AWN participated in the design of the ... (black) and skeletal muscle tissue from mice treated with a PPARd agonist (gray) containing the serine peak (d) Bar graph demonstrating the difference in the average inte...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "The pathophysiological function of peroxisome proliferator-activated receptor-γ in lung-related diseases" pptx
... mediated by the antagonism of the NF-κB pathway [31] Interleukin-5 (IL-5) is the principal regulatory cytokine mediating eosinophil airway inflammation and extending the cell's survival Eosinophils ... are phagocytes involved in the ingestion and degradation of inhaled particles This activates a variety of inflammatory processes involving enhancement of their cytotoxic capabilities...
Ngày tải lên: 12/08/2014, 18:22
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt
... AGGTCA TGCCCT t TCCCCC CAACCT t TACCCT GACCTA tt GAACTA t TACCTA AGACCT t TGAACC TCACCT t TCACCC – [54] [54] [58] [68] [69] [70] [71] FEBS Journal 272 (2005) 4754–47 73 ª 2005 FEBS 4765 Effect of ... (5¢-dACCGGAGAGGATATTTAGGCTGGGGCA TTGAAGGTTG -3 ; sense primer) vs Kin251 (5¢-dCAA CCTTCAATGCCCCAGCCTAAATATCCTCTCCGGT -3 ; antisense primer) to generate pGL3b:Prm3abPPARc(a)* Mutation of the...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Heme oxygenase-1 ⁄p21WAF1 mediates peroxisome proliferator-activated receptor-c signaling inhibition of proliferation of rat pulmonary artery smooth muscle cells pot
... PASMC proliferation Proliferation of PASMCs is a hallmark of pathogenesis of pulmonary hypertension [1,4] However, the mechanisms responsible for inhibition of PASMC proliferation by activation of ... Role of p21WAF1 in HO-1-mediated suppression of proliferation of PASMCs Recent studies have revealed that an antiproliferative effect of HO-1 on non-PASMC pulmonary...
Ngày tải lên: 15/03/2014, 10:20
Tài liệu Báo cáo khoa học: 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-c-dependent and mediated by the caspase-3-dependent apoptotic pathway doc
... PPARc agonist -induced apoptosis [26,27] In the present study, we investigated PPARc agonist -induced adipocyte apoptosis by using 3T3-L1 adipocytes and rat primary adipocytes Adipocyte apoptosis could ... troglitazone -induced adipocyte apoptosis is probably mediated by PPARc, GW9662 should have an inhibitory effect on adipocyte apoptosis As shown in Fig 2B...
Ngày tải lên: 16/02/2014, 09:20
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx
... 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢ for Ugt2b37; 5¢-GGGAAGGACATGAAGGAGAGAGC-3¢ and ... 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf
... the peroxisomal hydratase -dehydrogenase (HD) and L-FABP genes is activated by PPARa within a few hours and the mRNAs reach their maximal levels in a day in the liver but not in intestine [13] The ... mRNAs in intestine slowly increase during a few days of feeding a diet containing Wy14 643 This slow time course of induction is also the case for the intestine- specifi...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Peroxisome proliferator-activated receptor a–retinoid X receptor agonists induce beta-cell protection against palmitate toxicity doc
... Cytotoxicity 60 Effect of PPARa–RXR agonists on palmitate cytotoxicity C16:0 C16:0 + L-carnitine 40 % Cytotoxicity Palmitate oxidation (pmol/Kc/2h) A 1.50 Beta-cell protection against palmitate toxicity ... days with 500 lm palmitate (acute toxicity) and for days at 250 lm (chronic toxicity) Islet endocrine nonbeta-cells exhibited lower susceptibility to palmitate toxic...
Ngày tải lên: 23/03/2014, 07:20