Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

17 b -Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine Kiyoto Motojima Department of Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo, Japan In order to study the role of peroxisome proliferator-acti- vated receptor a in mouse intestine, its agonist-induced proteins were identified by peptide mass fingerprinting f ol- lowed by Northern blot analysis using their cDNAs. One of the most remarkably induced pro teins was identified as 17b-hydroxysterol dehydrogenase type 1 1. Its very rapid induction by various agonists was most efficient in i ntestine and then in liver. These findings together with recently reported results showing the enzyme family’s wide substrate spectrum, including not only glucocorticoids and sex ster- oids but also bile acids, fatty acids and branched c hain amino acids, suggest new roles for both peroxisome proliferator- activated receptor a and 17b-hydroxysterol dehydrogenase type 11 in lipid metabolism and/or detoxification in the intestine. Keywords: PPAR; intestine; hydroxysteroid dehydrogenase; lipid metabolism. Peroxisome proliferator-activated receptors [PPARa, b(d), and c] are members of the nuclear hormone receptor superfamily and function as ligand-dependent transcription factors, playing crucial r oles in s everal processes i ncluding energy metabolism, cellular differentiation, and i nflamma- tion [1,2]. It is now w ell accepted that PPARa is particularly important in lipid catabolism in the liver by upregulating the expression of a variety of genes that encode proteins involved in fatty acid transport [3], a-oxidation and lipoprotein metabolism [4,5]. However, it is important to point out that these studies have been mostly carried out using rodent models and s trong synthetic PPARa agonists. PPARa was originally cloned f rom a mouse cDNA library to explain a rodent-specific response c alled per- oxisome proliferation to a variety of synth etic c ompounds [6]. The amount of PPARa in the mouse liver is 10 times higher than that in human liver, and fibrates, hypolipidemic drugs and PPARa agonists do not cause peroxisome proliferation and a large induction of proteins involved in lipid metabolism i n human liver [7,8]. Thus there is a possibility that our knowledge on the ro le of PPARa in lipid metabolism is biased against its extra-hepatic functions. In this study, I examined the PPARa agonist-induced proteins in the intestine, another important organ for lipid metabolism e xpressing a fairly large amount of PPARa in mouse and human, to obtain new insight into t he roles of PPARa. A major change i n the intestine a t the protein level, namely a r apid induction of 17b-hydroxycholestrol dehy- drogenase type 11 (17b-HSD-11) by PPARa ligand, was identified. Materials and methods Animals and treatment Normal male C57BL and PPARa-null mice [9] were kept under a 12-h light–dark c ycle and provided w ith food and water ad libitum. Mice were fed either a control diet or a d iet c ontaining a drug a t t he concentration (%, w/w) and for the number of days or weeks indicated in the figure legends. All animal procedures were approved by the Meiji Pharmaceutical University Committee for E thics of Experi- mentation and Animal Care. Preparation of postnuclear fractions and SDS/PAGE analysis The livers and intestinal mucosa from wild (C57BL) or PPARa-null mice fed a control or a diet containing Wy14 643 {[4-chloro-6-(2,3-xylidino)-2-pyrimidinyl-thio]acetic acid} purchased from Tokyo-Kasei, Tokyo, Japan) for 5 d ays were homogenized in five volumes of sucrose buffer [0.25 M sucrose, 1 m M EDTA, 0.1% (v/v) ethanol, t he protease inhibitor mixture (Wako, Tokyo, Japan), pH 7.4] by Po tter–Elvehjem homogenizer [10]. The homogenates were centrifuged for 13 min at 2000 g and the supernatant, postnuclear fraction was obtained. Total proteins in the intestinal postnuclear fraction of wild-type mice fed a diet containing 0.05% Wy14 643 were separated b y SDS/PAGE (12% gel) as described previously [10]. Identification of Wy14643-induced proteins The proteins separated by SDS/PAGE were electric- ally transferred to a nylon membrane ( Immobilon, Millipore, MA, USA) and stained with Coomassie blue. The proteins of interest w ere excised fro m the membrane, Correspondence to Department of Biochemistry, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo 204–8588, Japan. Tel./Fax: +81 424 958474; E-mail: motojima@my-pharm.ac.jp Abbreviations: FABP, fatty acid binding protein; HSD, hydroxy- steroid dehydrogenase; PMF, peptide mass fingerprinting; PPAR, peroxisome proliferator-activated receptor. (Received 2 0 July 2004, revised 24 A ugust 2004, accepted 31 August 2004) Eur. J. Biochem. 271, 4141–4146 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04352.x carboxymethylated and digested with endoproteinase Lys-C. The resultant peptides were subsequently analyzed by MALDI-TOF mass spectrometry. The spectra were used to identify the proteins, using the MS - FIT search program [11]. Each protein band contained two or more proteins and the protein m ass fingerprinting alone could not identify the proteins of interest without ambiguity. RNA preparation and Northern blotting Total R NA was prepared f rom the mouse tissues and cultured cells by the acid guanidinium isothiocyanate/ phenol/chloroform extraction m ethod [12]. N orthern blot- ting analysis was carried ou t essentially as described previously using E xpress Hyb hybridization solution (Clon- tech, CA, USA) [13]. The cDNAs used for probes were described previously [3,14] or obtained by the cloning of PCR products of cDNA synthesized from poly(A + )RNA isolated from the liver of Wy14,543-fed mice. The synthe- ticoligonucleotides used to amplify the respective cDNA sequences were 5¢- GGGAATTCGTTTAGGACCGGGA ACGAGAGC-3¢ and 5¢- CCCTCGAGCGAAATCCCTG CAAGCACCTGT-3¢ for 17b-HSD-11 (corresponding to nucleotide numbers 62–860 of the published sequence with additional nucleo tides for restriction enzyme digestion underlined; GenBank accession number AK049355); 5¢- GGGAATTCGACGGGCGTGTGGTGTTGGTCA- 3¢ and 5 ¢- GGCTCGAGGAAGTGGCTTATACAGCTC CAA-3¢ for 17b-HSD-4 (corresponding to nucleotide num- bers 43–1273 of the published sequence w ith additional nucleotides underlined; GenBank accession number NM008292). The PCR products were digested with EcoRI and XhoI, cloned into a plasmid vector, and sequenced for identification. Cell culture and DNA transfection Fao cells (a subclone of rat hepatoma HIIE cells) were cultured in Ham’s F-12 medium, and CV-1 cells (monkey kidney-derived cells) w ere c ultured i n m inimal essential medium under the conditions des cribed previously [13]. APPARa ligand Wy14 643 was added to the medium at a final concentration of 50 l M (Fao cells) or 100 l M (CV-1 cells). A 1.8 kb DNA fragment containing possible enhancer sequences in the 17b-HSD-11 gene promoter was amplified by PCR using the mouse genomic DNA and the oligonucleotide primers. The entire fragment and digested enhancer truncated fragment were cloned i nto the enhancer vector pGL3 (Promega, WI, USA). Transfection was performed i n 24-well plates with SuperFect (Qiagen, CA, USA) using the Dual Luciferase assay system (Promega) according to the manufacturer’s protocol [13]. Results and Discussion SDS/PAGE analysis of the proteins whose expression levels were regulated by PPARa and its ligand To detect the protein bands whose expression levels were markedly altered by a dministration of a PPAR a ligand, postnuclear fractions of the liver and intestine were prepared from mice fed a PPARa ligand for 5 days. The result of one- dimensional SDS/PAGE analysis of these proteins from wild (C57BL) or PPARa-null mice f ed a c ontrol or Wy14,6 43- containing diet is shown i n Fig. 1. As already reported [14,15], several p roteins including peroxisomal enzymes were largely induced in the liver of wild mice by feeding Wy14 643 and it was difficult to assign uncharacterized new p rotein bands on one-dimensional gels. In contrast, the number of affected protein bands was limited in the intestine of wild mice and we chose three protein bands as uniquely increased in the i ntestine byWy14 643 in a PPAR a-dependent manner. These include proteins having molecular masses of 32, 78 and 80 kDa as shown b y arrows in Fig. 1B. Peptide mass fingerprinting (PMF) analysis of the PPARa-regulated proteins in the intestine Among the three proteins bands, I further selected P32 and P78 for PMF analysis, because they s eemed to b e expressed AB Fig. 1. Effects of Wy14 64 3 on protein expression in the liver and intestine of control and PPARa-null mice. Wild-type (+/ +) and PPARa-null mice (–/–) w ere fed either a control ( –) diet or one containing 0.05% Wy14 643 (+) for 5 days. T he prote ins in postnuclear fractions from th e liver and intestine were analyzed by SDS/PAGE ( 10%, w/v) followed by staining with Coomassie brilliant blue (A). The portion s (indicated by boxes) of the gel containing t he induced proteins (indicated by arrows) i n the intestine are shown enlarged (B). 4142 K. Motojima (Eur. J. Biochem. 271) Ó FEBS 2004 more in the intestine than in the liver and isolated from other major protein bands on the one-dimensional g el. After enzymatic digestion using endoproteinase Lys-C and ana- lysis of the resulting peptides by MALDI-TOF mass spectrometry, the masses of 12 among 29 peptides derived from P32 were consistent with those c alculated from the peptide sequences from 17b-HSD-11 (gi|16716597| ref|NP_444492.1|), and the masses of 1 2 p eptides m atched those f rom annexin IV ( gi|7304889|ref|NP_038499.1|). The masses of 18 among 79 peptides derived from P80 were consistent with those c alculated f rom the peptide s equences from 17b-HSD-4 (gi|1706397|sp.|P51660|). The peptides from P80 also contained 32 peptides from Ezrin (gi|32363497|sp.|P26040|) a nd 18 peptides from P450 oxidoreductase (gi|6679421|ref|NP_032924.1|). Among these proteins, 17 b-HSD-4 is known as a peroxisomal enzyme a nd induction of several peroxisomal enzymes in the liver has been extensively studied [16,17]. 17b-HSD-4 is not a major protein in the liver, but it could be identified a s a distinct protein b and on the one dimensional gel of all the proteins in the post nuclear fraction probably because of the absence o f abundant liver-specific proteins in the intestine. Furthermore, the increase of 17b-HSD-4 caused by the PP ARa ligand in the liver as protein amount was not remarkable when compared with that of mRNA, and Corton et al . suggested the possibility of post-trans- lational regulation of the protein levels in the liver [16]. It was noteworthy that t wo types of 17b-HSDs were identified as the most remarkably increased proteins in the intestine by PPAR a ligand in total protein mixture of the postnuclear fraction of the mouse intestine. 17b-HSD-4 is a multifunctional p rotein involved in not only i nactivation o f estradiol but also successive steps of a-oxidation of long- and b ranched-chain fatty acids in peroxisomes. In contrast, 17b-HSD-11 i s a new member of the 17 b-HSD family [18]. Mouse 17b-HSD-11 was found from a large set of full- length cDNAs by s equence homology and functional annotation [19] and human 17b-HSD-11 was identified in expressed sequence tag databas es with c onserved domains of the f amily members [20] and therefore its function has not been fully characterize d yet [18]. 17b-HSD-11 has no peroxisomal targeting signal at the C-terminus but a possible hydrophobic signal sequence at the N-terminus. The N-terminal sequence was expected to be cleavable by signal peptidase (SignalP, http://www.cbs.dtu.dk) but the exact N -terminal sequence was detected during PMF analysis of P32 protein as shown in Table 1. Thus 17b-HSD-11 should be a membrane protein and our preliminary d ata using green fluorescence protein linked to the C -terminus of the protein suggested a ssociation with the e ndoplasmic reticulum. I n contrast, C hai et al.[20] recently reported that the myc-tagged human 17b-HSD-11 at the N-terminus localized in the cytoplasm. The tagged myc sequence should have abolished the function of the Table 1. Summary of PMF analysis of P32 and P80. The residue numbers for P 32 are fro m the peptide seque nce of 1 7b-HSD-11 and those for P80 arefromthatof17b-HSD-4. Observed m/z Theoretical MH+ Delta Residues Peptide sequence Modification P32 766.45 766.47 )0.02 283–288 K)HRINVK 898.5 898.47 0.03 289–296 K)FDAVVGYK 936.52 936.51 0.01 151–161 K)AFLPVMMK 0Met–ox 1000.6 1000.58 0.02 63–70 K)LVLWDINK 1692.9 1692.87 0.03 140–153 K)TFEVNVLAHFWTTK 2527.6 2527.58 0.02 3–24 K)YLLDLILLLPLLIVFSIESLVK 2577.26 2577.24 0.02 83–105 K)LGAQAHPFVVDCSQREEIYSAAK 2630.44 2630.43 0.01 33–58 K)SVAGEIVLITGAGHGIGRLTAYEFAK 2951.45 2951.48 )0.03 162–189 K)NNHGHIVTVASAAGHTVVPFLLAYCSSK 2984.54 2984.5 0.04 228–254 K)NPSTNLGPTLEPEEVVEHLMHGILTEK 0Met–ox P80 620.34 620.34 0 472–476 K)RTSEK 620.34 620.34 0 560–564 K)VRFAK 745.49 745.46 )0.05 725–730 K)LQMILK 0Met–ox 873.54 873.52 0.02 636–643 K)SVGREVVK 925.53 925.23 0 707–714 K)AFFSGRLK 970.62 970.62 0 58–65 K)VVAEIRRK 1001.61 1001.61 0 636–644 K)SVGREVVKK 1117.65 1117.62 0.03 715–724 K)ARGNIMLSQK 0Met–ox 1229.67 1229.64 0.03 579–588 K)EGNRIHFQTK 1315.73 1315.68 0.05 645–655 K)ANAVFEWHITK 152.7 1352.63 0.07 69–81 K)AVANYDVEAGEK 1597.98 1597.97 0.01 247–259 K)LRWERTLGAIVRK 1728.92 1728.97 )0.05 169–184 K)LGILGLCNTLAIEGRK 1985.99 1985.94 0.05 384–402 K)SMMNGGLAEVPGLSFNFAK 1Met–ox 1986.99 1686.94 0.05 260–275 K)RNQPMTPEAVRDNWEK 1Met–ox 2820.47 2820.4 0.07 302–330 K)VDSEGISPNRTSHAAPAATSGFVGAVGHK 2969.45 2969.42 )0.03 141–168 K)QNYGRILMTSSASGIYGNFGQANYSAAK 0Met–ox Ó FEBS 2004 17b-HSD is a major PPAR a-regulated gene in intestine (Eur. J. Biochem. 271) 4143 N-terminal leader sequence. Table 1 summarizes assign- ment of the peptide masses to 1 7b-HSD-11 and 17b-HSD-4. Northern blot analysis of 17b-HSD-11 mRNA To confirm that intestinal expression of 17b-HSD-11 is regulated b y PPARa a nd W y14,643, we analyzed the e ffect of the drug on t he levels of 17 b-HSD-11 and 17b-HSD-4 mRNAs i n the liver and in testine of wild-type or PPARa- null mice (Fig. 2). Two types 17b-HSD mRNAs were largely induced in both the liver and intestine in a P PARa- and ligand-dependent manner. Their i nductions were more outstanding than those o f two typical PPAR a-target gene transcripts, liver-type fatty acid binding protein (L-FABP) and intestine-type fatty acid binding protein (I-FABP) mRNAs [3,21]. When compared to each other, some preference of 17b-HSD-11 for intestine and of 17b-HSD-4 for liver was observed. Thus it was confirmed that 17b- HSD-11 is a new protein whose expression is regulated by PPARa and i ts ligand in t he intestine. 17b-HSD-11 mRNA was efficiently induced by various types of PPARa activators in addition to a potent Wy14 643 (Fig. 3 ). The time course of the induction was very rapid not only in t he liver but also in intestine (Fig. 4) and the rapid induction of the mRNA by Wy14 643 was reproduced in the cultured hepatoma Fao cells (Fig. 5). Almost a m aximal level of induction was achieved in both tissues within a day, making a sharp contrast to the c ases of typical PP ARa-target genes so far studied [3,13,21]. Tran- scription of t he peroxisomal hydratase-dehydrogenase (HD) and L-FABP genes is activated by PPARa within a few hours and the m RNAs reach their maximal levels i n a day in t he liver but not in intestine [13]. The levels of their mRNAs in intestine slowly increase during a few days of feeding a diet containing Wy14 643. This slow time course of induction is also the case for the intestine-specific PPARa-target gene I-FABP [21]. Thus the induction of two 17b-HSD mRNAs by a PPAR ligand in the inte stine is much more efficient than that of typical PPARa-target genes. Promoter structure of the 17 b -HSD-11 gene and transcriptional regulation All the above d ata strongly suggest t hat expression o f the 17b-HSD-11 gene is directly regulated by PPARa and its ligand. So the genome database was searched for the Fig. 2. Influence of PPAR a and Wy14 643 on the expression levels of 17b-HSD-11 and 17b-HSD-4 mRNAs. Wild-type (+/+) and PPARa-null mice (–/–) were fed either a con- trol (–) d iet or one co ntaining 0.05% (w/v) Wy14 643 for 5 days. Total RNA from indi- vidual livers and intestines (5 lg) was analyzed by Northern blotting using cDNAs for 17b- HSD-11, 1 7b-HSD-4, 17b-HSD-10, liver-type fatty acid bin ding protein (L-FABP), i ntes- tine-type fatty acid binding protein ( I- FABP) and ribosomal S14 p rotein (S14, loading control). Fig. 3. PP ARa activator s pecificity for 17b-HSD-11 mRNA induction in the liver. Wild-type mice were fed e ither a co ntrol diet or one containing 0 .05% (w/v) Wy14,643, 0.5% (w/v) clofibrate, 2% (w/v) di(2-ethylhexyl)adipate (DEHA), or 2% (w/v) di(2-ethylhexyl)phtha- late (DEHP) for 5 d ays. Total RN A isolated from individual livers was subjected t o Northern b lot analysis using the cDNA prob es f or 17b- HSD-11, L-F ABP, a2u-globu lin ( a2u), and apolipoprotein E ( apoE, loading control). 4144 K. Motojima (Eur. J. Biochem. 271) Ó FEBS 2004 promoter sequence and PPAR b inding site. The mouse 17b-HSD-11 gene is located in cytoband E4 on chromo- some 5 and the sequence has been published (accession number, AL714024). S earching for a typical PPRE b y TRANSSEARCH program ( http://www.cbrc.jp/research/db/ TFSEARCHJ.html) in the region between 3 kb upstream and 2 kb downstream of the estimated transcriptional start site from t he 5 ¢ end of the reported cDNA [19] showed no significantly similar motif. T he cloned p ro- moter sequence up to )1800 bp from the transcriptional start site did not respond to a PPARa ligand Wy14 643 in the reporter gene a ssay (data not shown). Although an essential role of PPARa in the ligand-dependent tran- scriptional activation of the 17b-HSD-11 gene in the intestine became clear, whether another region of the gene is necessary or an unknown mechanism is operating for t he activation could not be clarified by the conven- tional methods used in this study. The molecular mechanism of the unusual induction of the 17b-HSD-11 gene in the intestine is clearly important and we are trying to solve this problem in our laboratory hoping to uncover a new role of PPARa in this organ. Possible roles of 17b-HSD-11 in the intestine Mouse 17b-HSD-11 may reside not in the e xtracellular space as previously predicted but in the cell probably on the membrane as no ted above. Suppo rting this p rospect, Chai et al . [20] recently reported that human normal liver parenchymal cells and epithelium of the endomerium and small i ntestine, as well as steroidogenic cells, were immuno- histochemically stained by anti-human 17b-HSD-11 I g. They also suggested that 1 7b-HSD-11 was localized to cytoplasm in the cell, but it should be associated with the endoplasmic reticulum (see above). 17b-HSD-11 b elongs to t he short-chain d ehydrogenase/ reductase superfamily (SDR family member 8) and also has a protein domain of glucose/ribitol dehydrogenase (Mouse Genome Informatics, http://www.informatics. jax.org). Recent studies on the specificities of several types of 17b-HSDs have revealed their wide substrate spectrum, including not only glucocorticoids and sex steroids but also bile acids, fatty acids and branched chain amino acids [18,22]. Thus 17b-HSDs in the epithelium of the intestine may metabolize potentially toxic compounds included in the diet to protect the organism, as s uggested by Chai et al. [20]. More work is required to address the in vivo function of 17b-HSD-11 and physiological significance of i ts rapid and marked induction by PPARa ligands in the intestine. Acknowledgements The author thanks Dr A. Iwamatsu (Central Laboratories f or Key Technology, Kirin Brewery Co. Ltd, Yokohama, Japan) for PMF analysis. References 1. G elman, L. & Auwerx, J. (1999) Peroxisome proliferator-activated receptors: mediators of a fast food impact on gene regulation. Curr. Opin. Clin. Nutr. Metab. Care 2, 307–312. 2. Hihi, A.K., Mic halik, L. & Wahli, W. (2002 ) PPARs: t ranscrip- tional effectors of fatty acids and their derivatives. Cell. Mol. Life Sci. 59, 790–798. 3. Motojima, K., Passilly, P., Peters, J.M. , Gonzalez, F.J. & Latruffe, N. (1998) Expression o f p utative fatty acid tr ansporter g enes are regulated by p eroxisom e proliferator-activated receptor a and c activators in a tissue- and i nd ucer-specific manner. J. Biol. Chem. 273, 16710–16714. A B Fig. 4. Time course of induction of 17b-HSD- 11 and 17b-HSD-4 mRNAs i n the liv er and intestine. (A) Wild-type mice were fed either a control diet o r one containing 0.05% Wy14 643 for 1–5 days as indicated. (B) W ild- type mice were fed either a co ntrol d iet o r o ne containing 0.5% (w/v) clofi brate (Clofib.) or 0.1% (w/v) t roglitazone (Trogli.) for 2 o r 8 weeks as indicated. Total RNA isolated from individual livers and i ntestine was s ub- jected to Northern blot analysis using cDNAs asdescribedinthelegendsofFigs2and3. Fig. 5. Time course of 17b-HSD-11 and 17 b-HSD-4 mRNA induction by Wy14 643 in hepatoma Fao cells. Wy14 643 was added to the medium of rat hepatoma Fao cells in the co nfluent stage at time 0 and the cells were collected at the time indicated for total RNA isolation and Northern b lotting analysis usin g the c DNA probes as described in the l egends of Figs 2 and 3. Ó FEBS 2004 17b-HSD is a major PPAR a-regulated gene in intestine (Eur. J. Biochem. 271) 4145 4. G elman, L ., Fruchart, J.C. & Auwerx, J . (1999) An update on the mechanisms of action of the perox isome proliferator-activated receptors (PPARs) and their r oles in inflammation and canc er. Cell. Mol. Life Sci. 55, 932–943. 5. Staels, B., Dallongeville, J., Auwerx, J., Schoonjans, K ., Leitersdorf, E. & Frucha rt, J.C. (1998) Mechanism of action of fibrates o n lip id and lipoprotein metabo lism. Cir culation 98, 2088–2093. 6. Issemann, I. & Green, S. (1990) Activation of a member of the steroid hormone receptor superfamily by peroxisome pro- liferators. Nature 347, 645– 650. 7. Palmer, C.N., Hsu, M.H., Griffin, K .J., Ra uc y, J .L. & Johnson, E.F. (1998) Peroxisome proliferator activated r eceptor-alpha expression in human liver. M ol. Pharmacol. 53, 14–22. 8. H olden, P.R. & Tugwood, J.D. (1999) Peroxisome proliferator- activated receptor alpha: r ole in rodent l ive r cancer and s peci es differences. J. Mol. Endocrin ol. 22, 1–8. 9. Lee, S.S., Pineau, T., Drago, J., Lee, E.J., O wens, J .W., K roetz, D.L., Fernandez-Salguero, P.M., Westphal, H. & Gonzalez, F.J. (1995) Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of t he pleiotropic effects of peroxisome p roliferators. Mol. Cell. Biol. 15, 3012–3022. 10. Motojima, K. & Goto, S. (1994) H istidyl phosphorylation and dephosphorylation of P 36 in rat liver extract. J. Biol. Chem. 269, 9030–9037. 11.Clauser,K.R.,Baker,P.&Burlingame,A.L.(1999)Roleof accurate mass measu rement (+/– 10 pp m) in protein iden tification strategies employing MS or MS/MS an d database searching. Anal. Chem. 71, 2871–2882. 12. Chom czynski, P. & Sacchi, N . (1987) Single-step method of RNA isolation by acid guanidinium th iocyanate-ph enol-chlorofo rm extraction. Anal. B iochem. 162, 156–159. 13. Sato, O., Kuriki, C., Fukui, Y. & Motojima, K. (2002) Dual promoter structure of mouse an d human fatty acid translocase/ CD36 genes a nd unique transcriptional a ctivation by peroxisome proliferator-activated receptor a and c ligands. J. Biol. Chem. 277, 15703–15711. 14. Fukui, Y., Masui, S., Osada, S., Umesono, K. & M otojima, K. (2000) A new thiazolidinedio ne, NC-2100, which is a weak PPAR-c activator, exhibits potent antidiabetic effects a nd induces uncoupling p rotein 1 i n white adipose tissue of KKAy obese mice. Diabetes 49, 759–767. 15. Motojim a, K., Ohmori, A., T akino, Y. & Goto, S. (1993) Increase in the amount o f elongation factor 2 in rat liver by peroxisome proliferators. J. Biochem. (Toky o) 114, 779–785. 16. Corton, J.C., Bocos, C., Moreno, E.S., Merritt, A., Marsman, D.S.,Sausen,P.J.,Cattley,R.C.&Gustafsson,J.A.(1996)Rat17 b-hydroxysteroid dehydrogenase type IV is a no vel peroxisome proliferator-inducible gene. Mol. Pharmacol. 50, 1157–1166. 17. Fan, L.Q., Cattley, R.C. & Corton, J.C. (1998) Tissue-specific induction of 1 7 b-hydroxysteroid dehydrogenase type IV by peroxisome proliferator chemicals is dependent on the p eroxisome proliferator-activated receptor a. J. Endocrinol. 158, 237–246. 18. Mindnic h, R., Moller, G. & Adamski, J. (2004) The role of 17b-hydroxysteroid dehydrogenases. Mol. Cell. Endocrinol. 218, 7–20. 19. Okaz aki, Y., Furuno, M., Kasukawa, T., Adachi, J., Bono, H., Kondo, S., Nikaido, I ., Osato, N., Saito, R., Suzuk i, H. et al. (2002) Analysis of the m ouse transcrip tome based o n fu nctional annotation of 60,770 full-len gth cDNAs. Nature 420, 563–573. 20. Chai, Z., Brereton, P., Suzuki, T., Sasano, H., Obeyesekere, V., Escher, G., S aff ery, R., Fuller, P., Enriquez, C . & K r ozowski, Z. (2003) 17b-Hydroxysteroid dehydrogenase t ype XI localizes to human steroidogenic cells. Endocrinology 144, 2084–2091. 21. Motojim a, K . (2000) Differential e ffects of PPARa activators o n induction of ec topic expression of tissue-specific fatty acid binding protein genes in the mouse liver. Int. J. Biochem. Cell. Biol. 32, 1085–1092. 22. Shafqat, N., Marschall, H .U., Filling, C., Nordling, E., Wu, X.Q., Bjork, L., Thyberg, J., M artensson, E., Salim, S ., Jornvall, H. & Oppermann, U . (2003) Expanded su bstrate screenings o f human and Drosophila type 10 17b-hydroxysteroid dehydrogenases (HSDs) reveal mult iple specificities in bile acid and steroid hor- mone metabolism: characterization of multifunctional 3a/7a/7b/ 17b/20b/21-HSD. Biochem. J. 37 6 , 49–60. 4146 K. Motojima (Eur. J. Biochem. 271) Ó FEBS 2004 . 17 b -Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a- regulated gene in mouse intestine Kiyoto Motojima Department of Biochemistry,. large amount of PPARa in mouse and human, to obtain new insight into t he roles of PPARa. A major change i n the intestine a t the protein level, namely a