Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... coenzyme analog lacking the ade- nine ring in the upper axial ligand; a model of damaged cofactors) for free adeninylpentylcobalamin (AdePeCbl) (an inactive coenzyme analog containing the adenine ring ... cavity is comparable with that of adenine- lacking cobalamins, and thus allows the damaged cofactor to pass through it. Intact cofactor, an ade- nine-containing cobalamin, is not rel...
Ngày tải lên : 15/02/2014, 01:20
  • 13
  • 620
  • 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC pYESTrp2 ⁄ PDIP46 ⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT pYESTrp2 ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ PDIP46(2) ⁄ SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAA...
Ngày tải lên : 19/02/2014, 05:20
  • 14
  • 517
  • 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT p21 WAF1/CIP1 Cyclin-dependent ... is downstream in the Nkx2-5 homeobox gene pathway. Development 124, 793–804. 24 Kanai H, Tanaka T, Aihara Y, Takeda S, Kawabata M, Miyazono K, Nagai R &am...
Ngày tải lên : 07/03/2014, 03:20
  • 16
  • 428
  • 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

... low at the beginning of the last larval stadium, but it gradually increased, reaching a peak at the wandering stage late in the last larval stadium. At the prepupal stage, EH activity declined ... (5¢-ATGGCGAAC ATCTGGCCACGAATC-3¢ and 5¢-TTATGAGAAATT GGCTTTCTGGAC-3¢) were used, and to prepare Actin 5C probe as an internal marker, primers (5¢-GTTCGA GACCTTCAACTCGC-3¢ and 5¢-TTCGAGATCCA CATC...
Ngày tải lên : 07/03/2014, 21:20
  • 10
  • 378
  • 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... b 2 -HAla, b 2 -homoalanine; b 3 -HAla, b 3 -homo- alanine; b 2 -HPhe, b 2 -homophenylalanine; Aib (aMeAla), a- amino- isobutyric acid; Sar, sarcosine (N-MeGly); ACE, angiotensin converting enzyme (E.C. ... conformational space of b-aminoacidsislargerthanthatofa-amino acids, but low-energy conformations of the b-amino acids backbone, corresponding to gauche rotamers around the Ca–Cb bond, ca...
Ngày tải lên : 08/03/2014, 08:20
  • 11
  • 860
  • 0
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt

Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt

... two days. As a control, cells were plated on a Luria–Bertani agar medium containing ampicillin and appropriate IPTG concentrations and incubated at 37 °C overnight. Flavin analysis The nature ... In this study, an Agrobacterium tumefaciens gene encoding a puta- tive alternative NADH dehydrogenase (AtuNDH-2) was isolated and expressed in Escherichia coli as a (His) 6 -tagged pr...
Ngày tải lên : 19/02/2014, 06:20
  • 13
  • 439
  • 0
Tài liệu Báo cáo khoa học: Octaketide-producing type III polyketide synthase from Hypericum perforatum is expressed in dark glands accumulating hypericins pdf

Tài liệu Báo cáo khoa học: Octaketide-producing type III polyketide synthase from Hypericum perforatum is expressed in dark glands accumulating hypericins pdf

... max CHS (X53958) Arachis hypogaea STS (L00952) Vitis vinifera STS (S63221) Rheum palmatum BAS (AF326 911) Humulus lupulus VPS (AB015430) Hydrangea macrophylla CTAS (AB 0114 68) Hydrangea macrophylla ... PKSs CHSs plants fungi bacteria Oryza sativa CHS (AB000801) Zea mays CHS (X60205) Ruta graveolens CHS (AJ297789) Gerbera hybrida CHS (Z38096) Arabidopsis thaliana CHS (AF112086) V...
Ngày tải lên : 18/02/2014, 18:20
  • 14
  • 451
  • 0
Báo cáo khoa học: Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions docx

Báo cáo khoa học: Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions docx

... a 1 )153 A GAAATGGAAAGT AL353732 Human IFN a 1 )166 G GAAAGCAAAAAA AL353732 Human IFN a 4b )123 G AAAATGGAAATT X02955 Human IFN a 4b )164 A GAAAGCAAAACA X02955 Chicken IFN1-2 )121 A GGAAGGGAAAGA ... A GAAAACGAAATC AJ583023 Fugu IFN )146 T GAAAAGCAAAGG AJ583023 Tetraodon IFN )148 T GAAATCCAAAAG AJ544889 Human IFN b )164 G AAAACTGAAAGG X00973 Human IFN a 1 )125 A GAAAGTGGAAA...
Ngày tải lên : 07/03/2014, 12:20
  • 14
  • 379
  • 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... 5¢- GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag under- lined) or 5¢- TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢- CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag ... 5¢- CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢- TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag...
Ngày tải lên : 07/03/2014, 21:20
  • 9
  • 422
  • 0
Báo cáo khoa học: Isocitrate dehydrogenase of Plasmodium falciparum Energy metabolism or redox control? doc

Báo cáo khoa học: Isocitrate dehydrogenase of Plasmodium falciparum Energy metabolism or redox control? doc

... 5¢-GCGCGCG GTCTCGAATGAACATATGCGGTAAAATTAACGT AG-3¢ and antisense 5¢-GCGCGCGGTCTCAGCGCT TGTTGAATGTTCTTGGGGAGC-3¢ containing BsaI restriction sites and ICDH-1 as a template and the following PCR programme: 3 min ... parasitaemia were isolated by saponin lysis according to [32]. Genomic DNA was isolated from the parasites according to Krnajski et al. 2002 [33]. Total RNA was isolated from the...
Ngày tải lên : 08/03/2014, 02:20
  • 9
  • 345
  • 0

Xem thêm