Microfluidic processes for protein separations

Microfluidic processes for protein separations

Microfluidic processes for protein separations

... applied for protein separation, and separation is based on the relative partitioning of the protein and impurities in these aqueous phases 1.4 Motivation: Microfluidics for Separation Microfluidic ... application of microfluidic systems for separation of proteins Specifically, the two systems studied in this thesis include microfluidic- magnetophoretic and aqueous two-phase mic...

Ngày tải lên: 09/09/2015, 10:19

189 254 0
Microfluidic processes for synthesis of plasmonic nanomaterials

Microfluidic processes for synthesis of plasmonic nanomaterials

... Examples of microfluidic processes for the synthesis of core-shell nanostructures (a) Schematic of the concept of synthesis of silica-titania core-shell structures (b) Stereomicroscopic image of the ... Figure 2.11 Examples of microfluidic processes for the synthesis of oxide nanoparticles (a) Photograph of PDMS microreactor used for multiphase gas-liquid...

Ngày tải lên: 09/09/2015, 18:53

224 453 0
Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx

Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx

... A system for protein evolution based on cell-free translation An initial DNA library is used as the template for cell-free translation Following genotype–phenotype (RNA protein or DNA protein) ... cellular models [25] Indeed, when Cell-free translation for protein engineering functional protein synthesis occurs inside liposomes, it provides a platform for simulati...

Ngày tải lên: 19/02/2014, 06:20

8 612 0
REQUIREMENTS FOR PROTEIN MEALS FOR RUMINANT MEAT PRODUCTION IN DEVELOPING COUNTRIES pot

REQUIREMENTS FOR PROTEIN MEALS FOR RUMINANT MEAT PRODUCTION IN DEVELOPING COUNTRIES pot

... 1984] Improving protein nutrition is the second strategy for increasing production in ruminants with a high protein requirements These include young animals following weaning, cows in the last ... weight The potential for ruminant production to be increased from poor quality forages is of the order of 5-10 fold without any increase in the demand for forage To attain su...

Ngày tải lên: 08/03/2014, 23:20

28 423 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTA...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... defined as physiological substrates for each protein kinase Specifically, protein phosphatase inhibitor-1 was used in the PKA, MAPK, Cdk1 and Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation ... migrating bands are Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation target (Eur J Biochem 271) 3551 Fig Phosphorylation of recombina...

Ngày tải lên: 16/03/2014, 18:20

9 497 0
Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf

Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf

... A ThermofluorÒ-adapted flavin ad hoc detection system F Forneris et al A B C Fig (A) Schematic representation of the ThermofluorÒ binding assay A solvatochromic dye (i.e SYPRO Orange) is used as ... named this modified ThermofluorÒ approach ‘ThermoFAD’ (ThermofluorÒ-adapted flavin ad hoc detection system) Results The ThermoFAD technique A ThermoFAD analysis requires...

Ngày tải lên: 23/03/2014, 04:21

8 465 0
Business Processes for Business Communities: Modeling Languages, Methods, Tools doc

Business Processes for Business Communities: Modeling Languages, Methods, Tools doc

... Business Processes for Business Communities i Frank Sch¨ nthaler o Andreas Oberweis Gottfried Vossen Thomas Karle Business Processes for Business Communities Modeling Languages, Methods, Tools ... various modeling constructs necessary for the modeling activities just described 3.3 Modeling Constructs for Business Processes In the modeling of business...

Ngày tải lên: 23/03/2014, 14:20

200 587 0
Defining Incident Management Processes for CSIRTs: A Work in Progress pdf

Defining Incident Management Processes for CSIRTs: A Work in Progress pdf

... security incident response team (CSIRT) processes and incident management processes in general In our research and training work, we find incident management performed in a variety of ways across ... these additional materials, organizations will be able to use the model as a framework for structuring initial incident management capabilities and sustaining and i...

Ngày tải lên: 23/03/2014, 23:21

249 475 0
Báo cáo khoa học: Novel strategy for protein production using a peptide tag derived from Bacillus thuringiensis Cry4Aa pptx

Báo cáo khoa học: Novel strategy for protein production using a peptide tag derived from Bacillus thuringiensis Cry4Aa pptx

... or more replicate experiments A 6xHis 4AaCter-TpN15 PP TpN15 B TpN17 4AaCter 4AaCter 4AaCter-TpN17 4AaCter 4AaCter-TpN47 4AaCter TpN47 4AaCter 4AaCter TpN15 TpN17 TpN47 ATG Ptac (kDa) 210 119 90 ... (Invitrogen, Carlsbad, CA, USA) and incubated with PreScission protease at a concentration of UÆ100 lg)1 protein to remove the · His–4AaCter tag The released · His–4AaCter tag and undige...

Ngày tải lên: 29/03/2014, 09:20

9 371 0
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

... Lẳ1 In addition, the amino acid-type bilinear indices can also be calculated Amino acid and amino acid-type bilinear indices are specic cases of local protein bilinear indices In this sense, the ... be the reason for the lack of linear correlation between protein bilinear indices and stability (tm) for these mutants, leading to a nonlinear depen...

Ngày tải lên: 29/03/2014, 09:20

29 406 0
w