Superoxide anion is implicated in the regulation of PP2A b56 mediated dephosphorylation of bcl 2
... subunit of PP1 PP2A Protein phosphatase 2A PP2A- A A scaffolding subunit of PP2A PP2AB56α B56 -containing PP2A enzyme PP2AB56γ1 B56 1-containing PP2A holoenzyme PP2AB56δ B56 -containing PP2A PP2A-C ... 90 O2- augmented the level of S70 pBcl -2 by inhibiting the holoenzyme assembly of B56 -containing PP2A (PP2AB56δ) 94 3.1 The B56 regulatory subunit of PP2A...
Ngày tải lên: 09/09/2015, 10:14
... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTA...
Ngày tải lên: 29/03/2014, 21:20
... across the BBB to the sites of axonal injury in the brain [33,37] Both in vitro and in vivo findings suggest that hypoxia/ischemia-induced infiltration of monocytes and macrophages contributes to the ... of inflammatory cytokines and chemokines during hypoxia; whereas NFκB is mainly involved in transcriptional regulation of these genes during the phase o...
Ngày tải lên: 19/06/2014, 22:20
báo cáo khoa học: "The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress" ppt
... Open Access The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress ... this article as: Galbiati et al.: The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulati...
Ngày tải lên: 11/08/2014, 11:21
Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf
... confirmed by Lin-54 binding to the CHR, cooperating with E2F4 binding to the CDE in EMSAs in vitro [86] ChIP experiments on the Cdc2 gene also provided insights into the association of other cell cycle ... proteins with the promoter E2F4 binding during the cell cycle coincides with the binding of p107 or p130 [61,85] Another E2F site distal to the E2F ⁄ CDE acts...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Roles of AP-2 transcription factors in the regulation of cartilage and skeletal development doc
... role of AP-2a and AP-2e in chondrogenesis Overview of the differentiation stages during chondrogenesis and the involvement of transcription factors (henatoxylin and eosin-stained section of an ... analyses of the regulation of AP-2 and the interactions of the transcription factor with binding partners, as well as of the regulation of target...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: A role of miR-27 in the regulation of adipogenesis ppt
... were maintained in a hypoxia chamber (Invivo 400; Ruskinn Inc., Cincinnati, OH, USA) constantly maintained at 1% O2 Culture medium was replaced every other day inside the chamber For miRNA transfection, ... were treated as described in (A) Total RNA was prepared at the indicated times and subjected to quantitative real-time PCR analysis The data shown are mean value ± standard err...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx
... Thus, integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling Similarly, sensing of glutamine-induced hepatocyte swelling by integrins feeds into ... Osmosensing and signaling in mammalian cell function F Schliess et al [7] On the other hand, hyperosmotic shrinkage prevents insulin-induced hepatocyte swelling...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: Roles of the SH2 and SH3 domains in the regulation of neuronal Src kinase functions pptx
... C-terminus Kinase domain and C-terminus SH3 domain and C-terminus SH2 domain and C-terminus SH3, SH2 domain and C-terminus N-terminal, SH3, SH2 domain and C-terminus N-terminal, SH3, SH2, kinase ... application of SH2 domain binding peptides, which results in blocking of the binding of the SH2 domain to the substrate and thereby preventing interac...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx
... 2675 Actin and ABPs in transcription regulation B Zheng et al Table Role of nuclear actin- binding proteins interacting with the androgen receptor AR, androgen receptor; LBD, ligand-binding domain ... STARS-interacting proteins These novel proteins contain four LIM domains and a C-terminal villin headpiece domain, which mediates actin- binding in several proteins,...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf
... raise the possibility that GSK3 may help to coordinate increases in glucose uptake and glycogen synthesis allowing for more effective ÔchannellingÕ of glucose into glycogen in response to insulin ... Effects of insulin, Li and SB-415286 on signalling elements implicated in the regulation of GSK3 and GS To further understand the effects of Li and...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc
... that mitochondria contribute to the induction of oxidative stress during ischemia ⁄ reperfusion in brain There is a growing body of information concerning the mechanism of ROS generation by the ... ADP inhibits opening of the mPTP by occupying binding sites located in the inner and outer mitochondrial membrane [39,40] The binding of ADP stabilizes...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx
... of glycogen in the intact liver in vivo Second, during infusion of [1-1 3C ]glucose, label incorporation was observed not only into the C1 of glycogen but also the C6 , which can only occur by label ... a mechanism can lead to increases in labeling of glycogen C6 even in the presence of decreased activity of the indirect pathway, provided that the increas...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo Y học: Identification of mammalian-type transglutaminase in Physarum polycephalum Evidence from the cDNA sequence and involvement of GTP in the regulation of transamidating activity potx
... might be similar to that by which they inhibit the enzymatic activity of TGase Hydrolysing activity of GTP was also found in the purified PpTGase protein as in the case of TGase Mammalian TGase ... Next, GTP- hydrolysing activity of the purified PpTGase was investigated Mammalian TGase has both transamidating and GTP- hydrolysing activities, whereas TGase has n...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc
... polyglutamine-expanded huntingtin [18], the tumor suppressor Synoviolin is involved in the degradation of nicastrin gene p53 [19] and Parkin-associated endothelin receptor-like receptor [20] In this ... whether Synoviolin is involved in the degradation of PS cofactors using synoviolin-null cells, as PS cofactors undergo the ubiquitin ⁄ proteasome pathway We r...
Ngày tải lên: 23/03/2014, 04:20