Molecular and cellular functions of the alternatively spliced isoforms of GDNF receptor complex in neuronal differentiation

Molecular and cellular functions of the alternatively spliced isoforms of GDNF receptor complex in neuronal differentiation

Molecular and cellular functions of the alternatively spliced isoforms of GDNF receptor complex in neuronal differentiation

... pathways involved in the activation of specific proteins, mRNAs and miRNAs through combinatorial interactions of GFLs, GFRα and RET receptor isoforms and provides novel insights into the diverse functions ... ligand receptor systems and microRNAs during neuronal differentiation of NTera2 neuroprogenitor cells (Chapter 8) The findings in this thesis further...

Ngày tải lên: 09/09/2015, 10:13

192 425 0
GDNF receptor complex in neuronal differentiation and breast cancer

GDNF receptor complex in neuronal differentiation and breast cancer

... 1.3 GDNF receptor complex in neuronal biology Since the discovery of the roles of GDNF in promoting survival and differentiation of midbrain dopaminergic (DA) neurons and increasing the affinity ... NT2 into specific neuronal lineages and study the roles of GDNF receptor system in neuronal differentiation and neuronal lineage specification 38 CHAPTER GDN...

Ngày tải lên: 30/09/2015, 10:11

103 148 0
Báo cáo sinh học: "Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication" pot

Báo cáo sinh học: "Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication" pot

... N-terminal and a Cterminal region of CIITA interacting with the viral transactivator, although, as stated above, only the Nterminal region is involved in the inhibition of Tax-2 function Interestingly, ... the replication of the human HTLV-2 retrovirus by inhibiting the function of the viral transactivator protein Tax-2 [21,22] However the bioche...

Ngày tải lên: 18/06/2014, 22:20

9 493 0
o cáo hóa học:" Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication" potx

o cáo hóa học:" Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication" potx

... of subcellular localization unveiled the co-localization of Tax-2 and CIITA both in the cytoplasm and the nucleus, and the role of CIITA in redirecting, upon binding, Tax-2 molecules mostly in ... by inhibiting the function of the viral transactivator protein Tax-2 [21,22] However the biochemical basis of the CIITA-mediated inhibition on...

Ngày tải lên: 20/06/2014, 04:20

9 405 0
Studies on the molecular and cellular mechanisms underlying the process of learning and memory formation   body

Studies on the molecular and cellular mechanisms underlying the process of learning and memory formation body

... relation to learning and memory formation requirements Furthermore, the molecular mechanisms underlying the MFs redistribution during learning and memory formation are still under investigation ... hilus and CA3 area, comprise the second synapse of the hippocampal circuit In this trisynaptic model of the hippocampus, based on the observations of th...

Ngày tải lên: 09/09/2015, 18:55

164 362 0
Studies on the molecular and cellular mechanisms underlying the process of learning and memory formation

Studies on the molecular and cellular mechanisms underlying the process of learning and memory formation

... 5.2.3.1 Fear conditioning training 115 5.2.3.2 Short-term contextual memory and cued memory test 115 5.2.3.3 Retention and extinction of long-term contextual memory and cued memory ... which have been done in this thesis to investigate the underlying mechanisms of learning process and long-term memory formation In part I, two projects have been focused on...

Ngày tải lên: 09/09/2015, 18:55

14 275 0
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf

Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf

... from the pia mater invade the brain and extend toward the ventricles [4] Like other vascular networks, brain vessels undergo formation, stabilization, branching, pruning and specialization In brief, ... transports water bidirectionally between the blood and the brain Astrocytes secrete water into the perivascular space via AQP4, thereafter maintaining water homeostas...

Ngày tải lên: 18/02/2014, 11:20

14 581 0
Báo cáo y học: " Detrimental effects of albuterol on airway responsiveness requires airway inflammation and is independent of b-receptor affinity in murine models of asthma" pdf

Báo cáo y học: " Detrimental effects of albuterol on airway responsiveness requires airway inflammation and is independent of b-receptor affinity in murine models of asthma" pdf

... Cite this article as: Lundblad et al.: Detrimental effects of albuterol on airway responsiveness requires airway inflammation and is independent of b-receptor affinity in murine models of asthma ... analysis, and assisted with data analysis EPR did the analysis of the histology and assisted in manuscript writing MEP did the Bio-Plex®® cytokine a...

Ngày tải lên: 12/08/2014, 13:22

12 300 0
Tài liệu Báo cáo khoa học: Molecular and cellular specificity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx

Tài liệu Báo cáo khoa học: Molecular and cellular specificity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx

... axon terminal in the sinus gland, as a result of late and progressive isomerization of the Phe3 of the CHH during the migration of the secretion vesicles along the axonal tract [39,41] The immunohistochemical ... (vitellogenesis inhibiting hormone) and CHH (crustacean hyperglycemic hormone) of the crustacean have the same precursor? Immunolocalization...

Ngày tải lên: 18/02/2014, 11:20

13 687 0
Investigations on the cellular and neuroprotective functions of nogo AReticulon 4a

Investigations on the cellular and neuroprotective functions of nogo AReticulon 4a

... by Nogo- A expression The same effects are also observed by Nogo- B expression On the other hand, while Nogo- C and RTN3 confer some degree of protection against serum deprivation, staurosporine and ... in the inhibition of neurite outgrowth 1.2 Molecular characterization of Nogo- A 1.2.1 Nogo: part of the Reticulon family Identification and characterization of...

Ngày tải lên: 11/09/2015, 10:06

198 241 0
Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

... terminus of the CRFR1 isoforms (Fig 1C) The predicted masses of the isoforms without/with V5 tag are as follows: CRFR1a (47.7/52 kDa), CRFR1e1 (10.8/ 15.1 kDa), CRFR1e2 (28.1/32.4 kDa), CRFR1f ... CRFR1 a, b, c and d isoforms differ in their ability to bind ligands and activate G proteins [10,16,25] CRFR1a is the most efficient in the stimulation of cAMP productio...

Ngày tải lên: 07/03/2014, 15:20

10 671 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Báo cáo khoa học: Functions and cellular localization of cysteine desulfurase and selenocysteine lyase in Trypanosoma brucei pot

Báo cáo khoa học: Functions and cellular localization of cysteine desulfurase and selenocysteine lyase in Trypanosoma brucei pot

... activities for the cysteine and selenocysteine substrates were measured in the noninduced and RNAi-induced knockdown cells for SCL characterized above, and also in the noninduced and Nfs RNAi-induced cells ... Esaki N (1997) Cysteine sulfinate desulfinase, a NIFS-like protein in E coli with selenocysteine lyase and cysteine desulfurase activities, gene cloning, pur...

Ngày tải lên: 22/03/2014, 21:20

11 326 0
Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

... this minireview is to summarize what is currently known about the molecular mechanisms of osmotic stress resistance, osmosensing and signal transduction in C elegans Osmosensing and signaling in ... process of interest, allows genes to be ordered into pathways, and can provide important and novel mechanistic insights into the molecular structure and functio...

Ngày tải lên: 30/03/2014, 03:20

8 496 1
w