role of wnt signaling and glycogen synthase kinase-3 beta in adipocyte biology

Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

... Cork, Ireland (Received 16 February 2 010 , revised 19 March 2 010 , accepted 23 March 2 010 ) doi :10 .11 11/ j .17 42-4658.2 010 .076 61. x Activation of the c-JUN N-terminal kinase (JNK) pathway is implicated ... c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis Ulla Sc...
Ngày tải lên : 16/02/2014, 14:20
  • 11
  • 580
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F...
Ngày tải lên : 18/02/2014, 11:20
  • 15
  • 635
  • 0
Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx

Tài liệu Báo cáo khoa học: Role of hydroxyl group and R/S configuration of isostere in binding properties of HIV-1 protease inhibitors docx

... 3525– 3601. Ó FEBS 2004 HIV-1 Protease Inhibitors (Eur. J. Biochem. 271) 4461 Role of hydroxyl group and R / S configuration of isostere in binding properties of HIV-1 protease inhibitors Hana Petrokova ´ 1 , ... on conformation of inhibitor main chain. Thus, different inhibitors differ not only in t he binding affinity, bu t a lso in the degree o...
Ngày tải lên : 19/02/2014, 16:20
  • 11
  • 615
  • 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... FEBS The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B 1 and B 2 bradykinin receptors Alexander Faussner 1 , Alexandra Bauer 1 , Irina Kalatskaya 1 , ... agonist [20]. As the internalization is expressed in percentage of total binding, decreasing the binding affinity of the Role of...
Ngày tải lên : 07/03/2014, 16:20
  • 12
  • 595
  • 0
Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

... increases in glucose uptake and glycogen synthesis allowing for more effective ÔchannellingÕ of glucose into glycogen in response to insulin. However, one of the potential difficulties in interpreting ... phosphatidylinositol 3-kinase, p70, S6 kinase and glycogen synthase kinase-3 activity in L6 muscle cells: evidence for the involvement of the mammalian...
Ngày tải lên : 08/03/2014, 08:20
  • 10
  • 804
  • 0
Role of an electrolyte and substrate on the stability of porous silicon

Role of an electrolyte and substrate on the stability of porous silicon

... improving the luminescent properties and stability of porous silicon films. 4. Conclusions The visual observation of mechanically strong, stable surface bond configuration, smooth surface morphology and ... surfaces essentially conforms the viability of textured substrates and ethanol-based electrolyte as a requisite condition for the formation of highly luminescen...
Ngày tải lên : 16/03/2014, 15:19
  • 9
  • 537
  • 0
Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx

Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx

... understood, and we have investigated these questions in this work. We sought to determine the role of protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl ... MS2 stability FEBS Journal 273 (2006) 14631475 ê 2006 The Authors Journal compilation ê 2006 FEBS 1473 Dissecting the role of protein–protein and...
Ngày tải lên : 30/03/2014, 11:20
  • 13
  • 448
  • 0
Báo cáo sinh học: "Wnt signaling and the developmental fate of lung cells" ppsx

Báo cáo sinh học: "Wnt signaling and the developmental fate of lung cells" ppsx

... form in the lungs of developing transgenic mouse embryos, cells appear within the lung that are more like cells of the gut than they are like their lung neighbors. The lung cells in the transgenic ... inflammation there is local up-regulation of Wnt signaling and the activity of ␤-catenin, and that this is then switching some of the cells to become progenit...
Ngày tải lên : 06/08/2014, 18:21
  • 5
  • 333
  • 0
Báo cáo y học: "γ The role of the complement and the FcγR system in the pathogenesis of arthritis" pdf

Báo cáo y học: "γ The role of the complement and the FcγR system in the pathogenesis of arthritis" pdf

... have resulted in a better understanding of the role of the complement system and FcγRs, although the relative contributions and the hierarchy of these two pathways in the manifestation of disease ... both the FcR and complement system, as part of the innate immune system, are involved in early immune defense and subsequently activate and instr...
Ngày tải lên : 09/08/2014, 06:23
  • 7
  • 476
  • 0
báo cáo khoa học: " Efficacy of Mesenchymal Stem Cells in Suppression of Hepatocarcinorigenesis in Rats: Possible Role of Wnt Signaling" doc

báo cáo khoa học: " Efficacy of Mesenchymal Stem Cells in Suppression of Hepatocarcinorigenesis in Rats: Possible Role of Wnt Signaling" doc

... 30:49 http://www.jeccr.com/content/30/1/49 Page 3 of 11 RESEARC H Open Access Efficacy of Mesenchymal Stem Cells in Suppression of Hepatocarcinorigenesis in Rats: Possible Role of Wnt Signaling Mohamed T Abdel aziz 1 , ... to cancer cells, nature of tumour cells and cancer stem cells, integrity of immune system, number of stem cell pas- sages an...
Ngày tải lên : 10/08/2014, 10:21
  • 11
  • 337
  • 0
Báo cáo y học: " Examination of effects of GSK3β phosphorylation, β-catenin phosphorylation, and β-catenin degradation on kinetics of Wnt signaling pathway using computational method" pdf

Báo cáo y học: " Examination of effects of GSK3β phosphorylation, β-catenin phosphorylation, and β-catenin degradation on kinetics of Wnt signaling pathway using computational method" pdf

... examined computationally. In the present study, the effects of phosphorylation of GSK3β and of phosphorylations and degradation of β-catenin on the kinetics of the wnt signaling pathway were examined ... GSK3β phosphorylation, β-catenin phosphorylation, and β-catenin degradation on kinetics of Wnt signaling pathway using computation...
Ngày tải lên : 13/08/2014, 16:21
  • 9
  • 200
  • 0
the role of il-33 and il-17 family cytokines in periodontal disease

the role of il-33 and il-17 family cytokines in periodontal disease

... IL-17F and IL-17A/F 46 1.4.4 Effect of IL-17A, IL-17F and IL-17A/F on target cells 47 1.4.5 Role of IL-17A, IL-17F and IL-17A/F in inflammation and infection 49  1.4.6 IL-17B, IL-17C and ... referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given The Role of IL-...
Ngày tải lên : 22/12/2014, 21:05
  • 325
  • 364
  • 0