In vitro and ex vivo effect of hyaluronic acid on erythrocyte flow properties pps
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b. ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A. thali- ana are already available [26]. We were able to obtain one T-DNA insertion line each for...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5Â-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3Â and 5Â-GCGGCATGCT CA GTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3Â (His-tag underlined); PSAG with ... FEBS Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Structural studies of the capsular polysaccharide and lipopolysaccharide O-antigen of Aeromonas salmonicida strain 80204-1 produced under in vitro and in vivo growth conditions docx
... of A. salmonicida strain 80204-1. Ó FEBS 2004 CPS and LSP O-antigen of A. salmonicida (Eur. J. Biochem. 271) 4513 Structural studies of the capsular polysaccharide and lipopolysaccharide O-antigen ... O-antigen of Aeromonas salmonicida strain 80204-1 produced under in vitro and in vivo growth conditions Zhan Wang 1 , Suzon Laroc...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: In vitro and in vivo self-cleavage of Streptococcus pneumoniae signal peptidase I pot
... of S. pneumoniae SPase I For in vitro self-cleavage of S. pneumoniae SPase I in the presence of phospholipid, 20 lL of reaction containing 5 lg of purified SPase I was incubated in 37 °Cfor2hin 20m M Tris/HCl ... When Fig. 2. Kinetic analysis of Self-cleavage of S. pneumoniae SPase I. Reactions (20 lL) containing different concentrations of SPase I as...
Ngày tải lên: 23/03/2014, 21:21
Báo cáo khóa học: Determination of modulation of ligand properties of synthetic complex-type biantennary N-glycans by introduction of bisecting GlcNAc in silico, in vitro and in vivo pot
... histopatho- logical and in vivo procedures. The question of whether introduction of the bisecting GlcNAc changes the ligand properties (binding affinities) of biantennary N-glycans for branch-end-specific lectins ... of synthetic complex-type biantennary N-glycans by introduction of bisecting GlcNAc in silico , in vitro and in vivo Sabin...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo hóa học: " N-methylisatin-beta-thiosemicarbazone derivative (SCH 16) is an inhibitor of Japanese encephalitis virus infection in vitro and in vivo" ppt
... Access Research N-methylisatin-beta-thiosemicarbazone derivative (SCH 16) is an inhibitor of Japanese encephalitis virus infection in vitro and in vivo Liba Sebastian 1 , Anita Desai* 1 , Madhusudana N ... 1-unin- fected cell control, lanes 2 and 4 – in vitro translation products of RNA obtained form JEV infected PS cells (untreated) at 4 and 10 ho...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Inhibition of foot-and-mouth disease virus replication in vitro and in vivo by small interfering RNA" pot
... report Inhibition of foot -and- mouth disease virus replication in vitro and in vivo by small interfering RNA Wang Pengyan, Ren Yan, Guo Zhiru* and Chen Chuangfu* Address: College of Animal Science and ... FMDV. Findings Foot -and- mouth disease (FMD) is an acute and highly contagious disease requiring expensive treatment occur- ring in cloven-hoofe...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Functional significance of the signal transduction pathways Akt and Erk in ovarian follicles: in vitro and in vivo studies in cattle and sheep" ppt
... effect of the Akt and Erk inhibitors on both granulosa and theca cells in com- bination. In summary, this study demonstrates a role for the Akt and Erk pathways in mediating the actions of FSH and ... differences in oestradiol and inhibin-A produc- tion in this present study might not relate directly to inhi- bition of the Akt and Erk pathway...
Ngày tải lên: 20/06/2014, 07:20
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
... RESEARCH Open Access In vitro and in vivo pre-clinical analysis of a F(ab’) 2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers Karen J Wong 1 , Kwamena E Baidoo 2 , ... is a good candidate for imaging . Studies are continuing with the panitumumab F(ab’) 2 to further evaluate the role of panitumumab F(ab’) 2 i...
Ngày tải lên: 21/06/2014, 02:20
Báo cáo hóa học: " CdTe quantum dots with daunorubicin induce apoptosis of multidrug-resistant human hepatoma HepG2/ADM cells: in vitro and in vivo evaluation" pptx
... 10 of 10 NANO EXPRESS Open Access CdTe quantum dots with daunorubicin induce apoptosis of multidrug-resistant human hepatoma HepG2/ADM cells: in vitro and in vivo evaluation Gen Zhang 1 , Lixin ... 81:891-909. doi:10.1186/1556-276X-6-418 Cite this article as: Zhang et al.: CdTe quantum dots with daunorubicin induce apoptosis of multidrug...
Ngày tải lên: 21/06/2014, 03:20
Báo cáo sinh học: " CNS progenitor cells and oligodendrocytes are targets of chemotherapeutic agents in vitro and in vivo" pdf
... provide rapid in vitro screens for analyzing new therapies and discovering means of achieving selective protection or targeted killing. In light of the ease of use of these in vitro and in vivo assays, ... Research article CNS progenitor cells and oligodendrocytes are targets of chemotherapeutic agents in vitro and in vivo Joerg Dietrich*, R...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo khoa học: "Effects of sustained subculture on apparent rejuvenation of the apple rootstock M.9 in vitro and in vivo" pps
... of sustained subculture on apparent rejuvenation of the apple rootstock M.9 in vitro and in vivo C.A. Webster O.P. Jones Institute of Horticultural Research, East Malling, ... the apparent reju- venation in vitro of the apple rootstock M.9 and the subsequent retention of juvenile characters in micropropagated plants in...
Ngày tải lên: 09/08/2014, 02:21
In vitro and ex vivo effect of hyaluronic acid on erythrocyte flow properties pps
... incubated in vitro with variable HA concentrations, and reversibility of HA effect. In vitro effect of several .hyaluronic acid (HA) concentrations on rigidity index (RI). Each sample was fractioned in ... leading to modifications in erythrocyte rheological and flow properties, both ex vivo and in vitro. Background Elevated seric hyaluronic acid...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Antiretroviral activity of the aminothiol WR1065 against Human Immunodeficiency virus (HIV-1) in vitro and Simian Immunodeficiency virus (SIV) ex vivo" pptx
... 1 of 10 (page number not for citation purposes) AIDS Research and Therapy Research Antiretroviral activity of the aminothiol WR1065 against Human Immunodeficiency virus (HIV-1) in vitro and Simian ... that WR1065 did not inhibit the antiretroviral activity of AZT. On the contrary, combination of WR1065 with AZT did increase the antiretrov...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Expression of aromatase and estrogen receptor alpha in chondrosarcoma, but no beneficial effect of inhibiting estrogen signaling both in vitro and in vivo" ppt
... Expression of aromatase and estrogen receptor alpha in chondrosarcoma, but no beneficial effect of inhibiting estrogen signaling both in vitro and in vivo. Clinical Sarcoma Research 2011 1:5. Submit your ... RESEARC H Open Access Expression of aromatase and estrogen receptor alpha in chondrosarcoma, but no beneficial effect of...
Ngày tải lên: 13/08/2014, 15:21