Báo cáo khoa học: In vitro and in vivo self-cleavage of Streptococcus pneumoniae signal peptidase I pot

In vitro and in vivo self-cleavage of Streptococcus pneumoniae signal peptidase I Feng Zheng, Eddie L. Angleton, Jin Lu and Sheng-Bin Peng Infectious Diseases Research, Lilly Research Laboratories, Indianapolis, IN, USA We have previously demonstrated that Streptococcus pneumoniae signal peptidase (SPase) I catalyzes a self- cleavage to result in a truncated product, SPase37–204 [Peng, S.B., Wang, L., Moomaw, J., Peery, R.B., Sun, P.M., Johnson, R.B., Lu, J., Treadway, P., Skatrud, P.L. & Wang, Q.M. (2001) J. Bacteriol. 183, 621–627]. In this study, we investigated the effect of phospholipid on in vitro self-cleavage of S. pneumoniae SPase I. In the presence of phospholipid, the self-cleavage predominantly occurred at one cleavage site between Gly36–His37, whereas the self- cleavage occurred at multiple sites in the absence of phospholipid, and two additional self-cleavage sites, Ala65–His66 and Ala143–Phe144, were identified. All three self-cleavage sites strongly resemble the signal pep- tide cleavage site and follow the ()1, )3) rule for SPase I recognition. Kinetic analysis demonstrated that self-cleav- age is a concentration dependent and intermolecular event, and the activity in the presence of phospholipid is 25-fold higher than that in the absence of phospholipid. Biochemical analysis demonstrated that SPase37–204, the major product of the self-cleavage totally lost activity to cleave its substrates, indicating that the self-cleavage resulted in the inactivation of the enzyme. More impor- tantly, the self-cleavage was demonstrated to be happening in vivo in all the growth phases of S. pneumoniae cells. The bacterial cells keep the active SPase I at the highest level in exponential growth phase, suggesting that the self- cleavage may play an important role in regulating the activity of the enzyme under different conditions. Keywords: Streptococcus pneumoniae; signal peptidase I; self- cleavage; inactivation; regulation. Many secreted and membrane proteins of both prokaryotic and eukaryotic cells are initially synthesized as a precursor (or preprotein) with an N-terminal extension known as a signal (or leader) peptide. This signal sequence is involved in guiding the protein into the targeting and translocating pathway by interacting with the membrane and other components of the cellular secretory machinery [1]. The signal peptides of secreted proteins are normally removed by signal peptidase (SPase) that spans in the cytoplasmic membrane in bacteria after the proteins have been translo- cated across the membrane. Two major bacterial SPases, SPase I and SPase II, with different cleavage specificity, have been identified. SPase I is responsible for processing majority of the secreted proteins [2,3], whereas SPase II exclusively processes glyceride-modified lipoproteins [4]. There is no sequence similarity and substrate overlap between these two types of SPases. In bacteria, the majority of protein translocation occurs post-translationally via the Sec system [5,6]. The Sec system is composed of multiple proteins SecA, SecB, SecD, SecE, SecF, SecG and SecY. In Escherichia coli, the homotetramer SecB, a chaperone protein, interacts with the newly synthesized precursor and targets the protein to the SecAYEG translocase at the cytoplasmic membrane surface. The secretory precursor then interacts with the membrane-associated homodimer SecA, which contains an ATP binding domain and utilizes the energy from ATP hydrolysis to translocate the precursor through the membrane protein channel thought to be formed from components SecYEG. SPase I is a membrane- bound endopeptidase that presumably is localized in close proximity to Sec YEG. it is typically anchored to the cytoplasmic membrane by one transmembrane segment in most of the gram-positive enzymes, or two transmem- brane segments in most of the gram-negative enzymes in the N-terminus. Topological analysis demonstrated that the C-terminal catalytic domain of E. coli SPase I resides on the outer surface of the cytoplasmic membrane, and is thus localized in the periplasm of the cells [7–9]. SPase I functions to cleave away the signal peptides from the translocated precursors, thereby releasing the mature proteins from the membrane and allowing them to their final destinations in the periplasm, outer membrane, or extracellular milieu. Inhibition of SPase I leads to the accumulation of secretory precursors in the cell mem- brane and eventual cell death [10–13]. Therefore, SPase I is an essential component for bacterial growth, and a potential target for development of novel antibacterial agents. Proteases in general are divided into four classes accord- ing to their mechanism of action, they are serine, cysteine, metallo- and aspartyl proteases. However, recent investiga- tions have unambiguously demonstrated that SPase I is not a member of any of these four traditional classes, it is not Correspondence to S. B. Peng, Lilly Research Laboratories, Lilly Corporate Center, Indianapolis, IN 46285, USA. Fax: + 1317 2769086, Tel.: + 1317 4334549, E-mail: Peng_Sheng-Bin@lilly.com Abbreviations:SPase,signalpeptidase;IPTG,isopropyl- b-thiogalactopyranoside; BHI, brain heart infusion. (Received 8 April 2002, revised 20 June 2002, accepted 28 June 2002) Eur. J. Biochem. 269, 3969–3977 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03083.x sensitive to any of the standard protease inhibitors [2,14]. The catalytic mechanism of the bacterial SPase I has been studied by site-directed mutagenesis using E. coli enzyme [15,16], Bacillus subtilis SipS [17] and S. pneumoniae enzyme [18]. In these cases, a conserved serine and a conserved lysine were identified to be critical for enzymatic activity. These results suggest that these enzymes belong to a novel class of serine proteases that utilize a serine and a lysine to form a catalytic dyad. Therefore, this class of protease is a unique serine protease that does not utilize a histidine as a catalytic base, but may instead employ a lysine side chain to fulfill this role [15,16,19]. This serine–lysine catalytic dyad struc- ture has been recently confirmed by structural analysis in E. coli SPase I [20]. A precedent for a mechanism involving a serine–lysine dyad for a peptidase has been previously reported [21–23]. The LexA protein, which is involved in the SOS response in E. coli, undergoes a specific self-cleavage reaction that inactivates the protein. The self-cleavage of LexA protein is important in the SOS response in bacteria [21–23]. In vitro self-cleavage was also observed in all investigated bacterial SPase I including enzymes from E. coli [24], B. subtilis [25] and S. pneumoniae [18]. In E. coli, the self-cleavage of SPase I occurred in a hydrophilic domain connecting the two transmembrane segments at the N-terminus [24]. In B. subtilis, the self-cleavage of SPase I (SipS) occurred immediately after the active residue serine [25]. In S. pneu- moniae, the self-cleavage site was identified between Gly36 and His37, one residue away from the active residue Ser38 [18]. Although in vitro self-cleavage is common in all investigated bacterial SPase I, the further studies on this basic biochemical property of the enzyme are very limited so far. We have previously demonstrated that S. pneumoniae SPase I catalyzes a self-cleavage reaction in the presence of phospholipid. After self-cleavage, the N-terminal 36 residues are removed from the protein, the major product (SPase37–204) consisting of amino acids 37–204, contains the two critical residues, Ser38 and Lys76, required for the formation of the catalytic dyad. However, we do not know if the self-cleavage is activating or inactivating the enzyme, and if the self- cleavage is happening in vivo within the bacterial cells. In the current study, we have shown that phospholipid enhances the activity of self-cleavage, and self-cleavage results in the inactivation of the enzyme. More impor- tantly, we have demonstrated for the first time that the self-cleavage of SPase I is happening within the S. pneumoniae cells in all the growth phases, and the cells maintain the active SPase I at the highest level in the exponential growth phase. MATERIALS AND METHODS Materials and bacterial strains Restriction enzymes, T4 DNA ligase and Taq DNA polymerase were purchased from Life Technologies, BRL Inc. The peptide substrate (KLTFGTVKPVQAIA GYEWL) was developed and synthesized based upon the signal peptide of prestreptokinase of S. pyogenes,as described previously [26,27]. CM- and DEAE-Sepharose and an ECL kit for Western blot analysis were obtained from Amershan-Pharmacia. Ni-nitrilotriacetic acid agarose was from Qiagen. E. coli lipid extract and pure phospho- lipids were purchased from Avanti Polar Lipid, Inc. Trifluoroacetic acid, EDTA, and acetonitrile were pur- chased from Fisher Scientific. Chemicals for SDS/PAGE were from Nova. All HPLC measurements were performed on a HP 1100 system using C18 reversed-phase column. E. coli strain Bl21(DE3)pLysS was from Novagen, and S. pneumoniae R6 strain was from American Type Culture Collection. Purification of S. pneumoniae SPase I The expression vector, pET16b-spi, that directs the synthesis of the full length S. pneumoniae SPase I, was constructed and transformed into E. coli strain BL21(DE3) pLysS. The transformed E. coli cells were grown and induced with IPTG for protein expression at 30 °C. The overexpressed protein was purified as described previously [18]. Typically, 1 L of IPTG-induced E. coli cells were lysed by sonication in 20 mL of lysis buffer containing 300 m M NaCl and 50 m M Na 2 HPO 4 (pH 8.0). The lysate was then centrifuged at 50 000 g for 1hat4°C. The resultant supernatant was discarded, and the pellet was resuspended and sonicated in 20 mL of lysis buffer with 1% Triton X-100. After centrifugation at 50 000 g for 1 h, the supernatant was diluted with 80 mL of lysis buffer, and loaded to a 2 mL of Ni-nitrilotriacetic acid column, that was then washed with 50 mL of lysis buffer with 0.1% Triton X-100 and 15 m M imidazole. Finally, the protein was eluted with 10 mL of elution buffer containing 20 m M Tris/HCl (pH 8.0), 20% glycerol, 0.1% Triton X-100 and 100 m M imidazole. The purity of the protein was analyzed by SDS/PAGE, and selected fractions were utilized for enzyme assays. Purification of truncated SPase37–204 from self-cleaved SPase I Purified SPase I (5 mg) was incubated for 2 h at 37 °Cin 5 mL of reaction buffer containing 20 m M Tris/HCl (pH 8.0), 100 m M imidazole, 20% glycerol, 0.1% Triton X-100 and 1 lgÆlL )1 of E. coli lipid extract. The reaction mixture was diluted to 50 mL with 20 m M Tris/HCl (pH 8.0), and loaded into a 2 mL of Ni-nitrilotriacetic acid agarose column. The pass flow from Ni-nitrilotriace- tic acid agarose column was loaded to a 1 mL of CM-Sepharose column, and subsequently to a 1 mL of DEAE-Sepharose column that was preequilibrated with buffer A consisting of 20 m M Tris/HCl (pH 8.0), 20% glycerol. After washing the DEAE-Sepharose column with 5 mL of buffer A, the protein was eluted with 10 mL of 0–400 m M NaCl gradient prepared in buffer A, 1 mL of fractions were collected, and selected fractions were utilized for functional assay. Overexpression and purification of truncated S. pneumoniae SPase37–204 To develop a simpler method to purify S. pneumoniae SPase37–204, we constructed an expression vector, pET23b-spiD1-36, that directs the expression of SPase I lacking the N-terminal 36 amino acids with a C-terminal 3970 F. Zheng et al. (Eur. J. Biochem. 269) Ó FEBS 2002 histidine tag. Briefly, the encoding region for residues 37–204 of S. pneumoniae SPase I was amplified by PCR using genomic DNA as the template and two oligonucleo- tides as primers (5¢-GCAATGTTCGCGTACATATGCA TTCCATGGATCCGACC-3¢ and 5¢-TGGTGGTGCTC GAGAAATGTTCCGATACGGGTGATTGGCCAGA AGCG-3¢), which were designed to contain NdeIandXhoI restriction sites at the 5¢ ends, respectively. The primers were synthesized in accordance with the published sequence of S. pneumoniae SPase I [28]. The PCR product was puri- fied and cloned into the NdeIandXhoI sites of vector pET23b, resulting in pET23b-spiD1-36. The identity of the cloned gene was confirmed by DNA sequencing. For expression of SPase37–204, E. coli strain BL21(DE3)- pLysS was transformed with pET23b-spiD1-36, grown and induced with 0.4 m M IPTG at 30 °C, as described previously [29]. For purification, 1 L of the IPTG-induced E. coli cells were harvested by centrifugation, resuspended in 40 mL of lysis buffer, and sonicated for 5 min on ice. The lysate was then centrifuged at 50 000 g for 1 h. The resultant supernatant was loaded onto a 2 mL preequil- ibrated Ni-nitrilotriacetic acid column, which was then washed with 50 mL of lysis buffer with 15 m M imidazole. The protein was finally eluted out with 10 mL of elution buffer, and 1 mL of fractions were collected and analyzed by SDS/PAGE. In vitro self-cleavage of S. pneumoniae SPase I For in vitro self-cleavage of S. pneumoniae SPase I in the presence of phospholipid, 20 lL of reaction containing 5 lg of purified SPase I was incubated in 37 °Cfor2hin 20m M Tris/HCl (pH 8.0), 0.05% Triton X-100, 10% glycerol, and 50 lgofE. coli lipid extract. For self- cleavage in the absence of phospholipid, 20 lL of reaction containing 5 lg of purified SPase I was incubated at 37 °C in the same buffer without phospholipid. Typically, the reactions were terminated by the addition of SDS sample buffer, and separated on a 4–20% SDS/poly- acrylamide gel; the gel was then stained with Coomassie Brilliant Blue. For kinetic analysis of self-cleavage, reac- tions (20 lL) containing different concentrations of SPase I were incubated at 37 °Cfor30mininthe presence of 50 lg phospholipid or 4 h in the absence of phospholipid. Densitometer analysis was performed using a Personal Densitometer SI and IMAGE QUANT 5.0 soft- ware from Molecular Dynamics. Specific activities of self- cleavage in the presence or absence of phospholipid were calculated according to the cleavage of SPase I at concentration of 1 mgÆmL )1 . N-Terminal peptide sequencing To determine the self-cleavage sites of S. pneumoniae SPase I, the proteolytic products of the self-cleavage were fractionated on a 4–20% SDS/polyacrylamide gel, and transferred to a poly(vinylidene difluoride) (PVDF) mem- brane by electroblotting. The membrane was then briefly stained by Commassie bright blue and destained by 50% methanol. The visualized protein bands on the membrane were excised and the N-terminal amino acid sequence of each protein was determined by automated Edman degradation. Cleavage of prestreptokinase by S. pneumoniae SPase I and SPase37–204 We have previously demonstrated that prestreptokinase is a native substrate of S. pneumoniae SPase I. The gene encoding S. pyogenes prestreptokinase was amplified by PCR based upon the published sequence [26], and cloned into the expression vector pET23b to result in pET23b-ska. For the expression of the prestreptokinase, E. coli strain BL21(DE3)pLysS was transformed with pET23b-ska, grown and induced by IPTG. The overexpressed prestrep- tokinase was then solubilized with 1% Zwittergent 3–16, and purified with Ni-nitrilotriacetic acid column, as described previously [18]. For the cleavage of prestrepto- kinase, typically, reactions (20 lL) containing 0.1 lgSPase I or SPase37–204 were incubated with 5 lg of purified prestreptokinase at 37 °C for 1 h in the buffer containing 20m M Tris/HCl (pH 8.0), 0.02% Triton X-100, 5% glycerol and 50 lgofE. coli total lipid extract. The reactions were then terminated by the addition of SDS sample buffer, and the proteins were separated on a 4–20% SDS/poly- acrylamide gel, and stained by Coomassie Brilliant Blue. Cleavage of a peptide substrate by S. pneumoniae SPase I and SPase37–204 A peptide substrate, KLTFGTVKPVQAIAGYEWL was developed and synthesized based upon the signal peptide of the prestreptokinase of S. pyogene [26,27]. Typically, cleavage reactions were performed in 50 lL reaction mixtures containing 20 m M Tris/HCl (pH 8.0), 50 lgof E.coli lipid extract, 0.1 l M SPase I and 100 l M of the peptide substrates. Reactions were incubated at 37 °Cfor 2 h and terminated by the addition of an equal volume of 8 M urea. Cleavage of the peptide substrate was deter- minedbyHPLCusingaHewlettPackardSeries1100 system equipped with an autosampler. The reaction mixtures were injected into a reversed-phase column (Vydac C18) and the fragments were separated using a 0–67% linear gradient of buffer B in buffer A (buffer A ¼ 0.1% trifluoroacetic acid in water, buffer B ¼ 90% acetonitrile and 0.1% trifluoroacetic acid) with a flow rate of 1 mLÆmin )1 . Peak detection was accomplished by monitoring the absorbance at 214 nm. Preparation of a polyclonal antibody against S. pneumoniae SPase I Two S. pneumoniae SPase I-specific peptides, SP-Ab1 (CHEEDGNKDIVKRVIG) and SP-Ab2 (CLADYIK RFKDDKLQS), were synthesized based upon the deduced amino acid sequence [28]. A cysteine was artificially added to the N-terminus of each peptide to increase the coupling efficiency. After purification, the synthetic peptides were coupled to keyhole limpet hemocyanin, and utilized for immunization of New Zealand white rabbits to generate polyclonal antibodies, as described previously [30]. Detection of in vivo self-cleavage of S. pneumoniae SPase I by Western blot analysis Fresh S. pneumoniae cells were prepared by growing the cells in 5 mL of brain–heart infusion (BHI) broth in a Ó FEBS 2002 Self-cleavage of S. pneumoniae SPase I (Eur. J. Biochem. 269) 3971 series of dilution at 37 °Cwith5%CO 2 overnight. The culture with D 620 < 0.3 was carefully centrifuged, washed once with fresh BHI broth. The cells were then resuspended in fresh BHI broth with an initial D 620 ¼ 0.075, and grown at 37 °Cand5%CO 2 for a period up to 5 h. 2 mL of culture was harvested at different time points by centrifugation and immediately lysed with a solution containing 1· SDS sample buffer, B-PER II bacterial extraction reagent from Pierce and a protease inhibitor cocktail from Roche to protect proteins from nonspecific proteolysis. After boiling for 10 min, the samples (20 lg of total protein each) were separated on a 4–20% SDS/polyacrylamide gel and transferred electroph- oretically to a PVDF membrane. Immunodetection was performed using immune serum against S. pneumoniae SPase I at 1 : 2000 dilution or a polyclonal antibody against S. pneumoniae Eraat1:1000dilution.Densitom- eter analysis was performed using a Personal Densitometer S1 and IMAGE QUANT 5.0 software. The ratio of the full length SPase/cleaved SPase was calculated based upon the relative intensity of the two protein bands from Western blot analysis. RESULTS In vitro self-cleavage of S. pneumoniae SPase I We have previously reported that S. pneumoniae SPase I catalyzes a specific self-cleavage reaction in vitro.A similar self-cleavage reaction was also observed in purified E. coli SPase I [24]. The self-cleavage of E. coli SPase I was initially speculated to be protected within the bacterial cells by the interaction between the enzyme and the cytoplasmic membrane. In this study, we were interested in investigating the effect of phospholipid on the self-cleavage of S. pneumoniae SPase I. In the pres- ence of phospholipid, the self-cleavage occurred predom- inantly at one cleavage site to produce two protein bands, b1 and b4, as demonstrated in Fig. 1A; no other cleavage site was observed. In the absence of phosphol- ipid, the highly purified S. pneumoniae SPase I, when incubated at 37 °C, also resulted in the self-cleavage of the enzyme. Interestingly, the self-cleavage was somewhat different, it occurred at multiple sites and resulted in at least five identifiable protein bands, b1, b2, b3, b4, and b5 with molecular masses ranging from 8 to 19 kDa, as shown in Fig. 1B. To confirm the specificity of the self- cleavage, we also tested the self-cleavage of two SPase I mutants, S38A and K76A that lost their activity to catalyze substrate cleavage as described previously [18]. Results demonstrated that the purified S38A and K76A were unable to catalyze self-cleavage in the presence or absence of phospholipid, confirming that the self-cleavage in both conditions was specific and not due to the possibly contaminating proteases (data not shown). Additionally, all the major protein bands from the self- cleavage of SPase I were separated, excised and subjected for N-terminal peptide sequencing. The sequences obtained from five cleaved protein bands were summa- rized in Table 1. In the absence of phospholipid, three self-cleavage sites, Gly36–His37, Ala65–His66, and Ala143–Phe144 were identified as indicated in Fig. 1C. In the presence of phospholipid, only one self-cleavage site (Gly36–His37) was identified. The peptide sequence GHHHHHHHHHHSSG from products b2 and b4 was the histidine tag fused to the N-terminus of the enzyme. Kinetics of SPase I self-cleavage Kinetic analysis demonstrated that self-cleavage was a protein concentration dependent event. Titration experi- ments revealed that the specific activities of self-cleavage in the presence of phospholipid were increasing when SPase I concentrations were increased (Fig. 2A). A similar protein concentration-dependent self-cleavage of SPase I was also observed in the absence of phospholipid (Fig. 2B). It suggests that self-cleavage of SPase I is catalyzed through an intermolecular mechanism. The activities of self-cleav- age in the presence or absence of phospholipid were calculated to be 0.025 or 0.001 min )1 , respectively, at SPase I concentration of 1 mgÆmL )1 ,anda25-fold Fig. 1. Self-cleavage of S. pneumoniae SPase I. Reactions (20 lL) containing 5 lgof wild type SPase I were incubated at 37 °Cin the presence (A) or absence (B) of phospholi- pid. The samples were separated on 4–20% SDS/polyacrylamide gels, and stained with Coomassie Brilliant Blue. Lane 1, purified full length SPase I before incubation; lane 2, full length SPase I after incubation. Protein bands corresponding to degradation products of S. pneumoniae SPase I were indicated as b1, b2, b3, b4 and b5. (C) Amino acid sequence of S. pneumoniae SPase I. The self-cleavage sites, identified by automated Edman degradation, are marked with arrows. The peptides utilized for antibody preparation are underlined. 3972 F. Zheng et al. (Eur. J. Biochem. 269) Ó FEBS 2002 stimulation by phospholipid was observed. Therefore, phospholipid greatly stimulates the self-cleavage of SPase I. Self-cleavage sites of S. pneumoniae SPase I resemble signal peptide cleavage sites Although signal peptides of secreted proteins do not show a great deal of sequence identity, they do share some common structural properties. Statistical analysis of the amino acid sequences surrounding signal peptide cleavage sites has led to the so called ()1, )3) rule that states that the residues at the )1and)3 positions relative to the SPase I cleavage site must be small and neutral residues [31–33]. The residues at )1 position are usually Ala, Gly, and Ser, and at )3 position are usually Ala, Val, Gly, Ser, and Thr. Sequence analysis around the three self-cleavage sites identified from S. pneumoniae SPase I revealed that all these self-cleavage sites strongly resemble the signal peptide cleavage sites, and follow the ()1, )3) rule well with the most common alanine or glycine in the )1 position, and an alanine or a valine at )3 position as demonstrated in Fig. 3. This result further supports that the self-cleavage of SPase I with or without phospholipid is specific and not caused by possibly contaminating proteases from the purification or by careless handling of the protein. Similarly, the self- cleavage sites identified from E. coli and B. subtilis SPases also follow the ()1, )3) rule for signal peptidase recognition as aligned in Fig. 3. Purification of truncated S. pneumoniae SPase37–204 from self-cleaved products and overexpressed E. coli cells We have demonstrated that S. pneumoniae SPase I pre- dominantly catalyzes self-cleavage at one cleavage site between Gly36 and His37 in the presence of phospholipid. The major product of this cleavage, SPase37–204 still contains residues Ser38 and Lys76, which are two active residues to form a catalytic dyad [18]. Therefore, we are interested in comparing the enzymatic activity of the full length enzyme with this truncated product. For this purpose, we developed a procedure to purify SPase37–204 from the reaction mixture of the self-cleavage. When Fig. 2. Kinetic analysis of Self-cleavage of S. pneumoniae SPase I. Reactions (20 lL) containing different concentrations of SPase I as indicated were incubated at 37 °C for 30 min or 4 h in the presence (A) or absence (B) of phospholipid. The samples were separated on 4–20% SDS/ polyacrylamide gels and stained with Coomassie Brilliant Blue. Densitometer analysis was performed with a Personal Densitometer SI and IMAGE QUANT 5.0 software from Molecular Dynamics. Percentage of the self-cleavage was calculated according to the decrease of the full length SPase I in each reaction. Table 1. N-terminal sequences of self-cleaved products of S. pneumoniae SPase I. N-terminal sequences of two cleaved products, b1 and b4 in the presence of phospholipid, and five cleaved products, b1, b2, b3, b4 and b5 in the absence of phospholipid were determined by automated Edman degradation. Peptide sequences Product M r (kDa) Phospholipid No phospholipid b1 b2 19 18 HSMDPTLADGE HSMDPTLADG GHHHHHHHHHHSS b3 15 HEEDGNKDIV b4 9 GHHHHHHHHHHSSGF GHHHHHHHHHHSSG b5 8 FTVDVNYNTNFSFT Fig. 3. Self-cleavage sites of S. pneumoniae SPase I resemble signal peptide cleavage sites. The three self-cleavage sites of S. pneumoniae SPase I identified by automated Edman degradation were aligned along with the self-cleavage sites identified from E. coli and B. subtilis enzymes. Self-cleavage sites are marked with arrow. The )1and)3 positions relative to the cleavage sites are highlighted. Ó FEBS 2002 Self-cleavage of S. pneumoniae SPase I (Eur. J. Biochem. 269) 3973 reaction mixture was passed through a Ni-nitrilotriacetic acid agarose column, the uncleaved SPase I and the N-terminal product containing a histidine tag bound to the Ni-nitrilotriacetic acid column. The C-terminal product, SPase37–204, passed through the Ni-nitrilotriacetic acid column, was further purified by chromatography utilizing a CM- and a DEAE-Sepharose column as described under the Materials and methods. The purified SPase37–204, we called it the self-cleavage-generated SPase37–204, was utilized for activity analysis. As the self-cleavage-generated SPase37–204 may have lost its activity due to a relatively complicated and lengthy purification protocol, we also constructed an expression vector, pET23b-spiD1-36 to direct the overexpression of SPase37–204 with a C-terminal His tag. The overexpressed SPase37–204 was easily solubi- lized by a simple salt extraction and purified to near homogeneity by one step Ni-nitrilotriacetic acid agarose chromatography as described under the Materials and methods. Approximately 5 mg of purified protein was obtained from 1 L of IPTG-induced E. coli cells. SPase37–204 loses its ability to cleave its native substrate, prestreptokinase We have previously identified prestreptokinase, an extra- cellular protein in pathogenic streptococci to be cleaved between Ala26 and Ile27 by S. pneumoniae SPase I [18]. To evaluate the activity of SPaseD37–204, we incubated the substrate with the self-cleavage-generated SPase37–204 in the presence of phospholipid. As demonstrated in Fig. 4, lane 2, the purified SPase37–204 was unable to cleave prestreptokinase. It indicated that the major product of the SPase I from self-cleavage was not active. Similarly, the overexpressed SPase37–204, that was purified simply by one step Ni column was unable to cleave prestreptokinase either as shown in Fig. 4, lane 3, whereas the full length SPase I cleaved the substrate effectively (Fig. 4, lane 4). These results indicate that SPase I lacking the N-terminal 36 amino acids has lost its activity to cleave its native substrate, prestreptokinase. SPase37–204 loses its ability to cleave a peptide substrate Based upon the signal peptide sequence of prestreptokinase, we developed a peptide substrate, KLTFGTVKPVQAIA GYEWL that was effectively and specifically cleaved between Ala and Ile by the full length S. pneumoniae SPase I [27]. As demonstrated by HPLC analysis in Fig. 5, this 19 amino acid peptide substrate had a retention time of 4.25 min. When it was incubated with the full length SPase I in the presence of phospholipid, two products were generated with retention times of 3.32 and 3.88 min, respectively (Fig. 5A). Mass spectrum analysis of the two products confirmed that the cleavage specifically occurred between residues Ala–Ile as expected (data not shown). However, when the peptide substrate was incubated with Fig. 4. SDS/PAGE analysis of purified prestreptokinase and its cleav- age by full length SPase I and SPase37–204. Reactions containing 0.1 lg SPase I or SPase37–204 were incubated with 5 lgofpurified prestreptokinase at 37 °C for 1 h in the buffer containing 20 m M Tris/ HCl (pH 8.0), 0.02% Triton X-100, 5% glycerol and 50 lg phos- pholipid. The reactions were terminated by the addition of SDS sample buffer, and the proteins were separated on a 4–20% SDS-poly- acrylamide gel, and stained by Coomassie Brilliant Blue. Lane 1, prestreptokinase (pre-Ska); lane 2, prestreptokinase plus self-cleavage- generated SPase37–204; lane 3, prestreptokinase plus overexpressed SPase37–204; and lane 4, prestreptokinase plus full length SPase I. Prestreptokinase was processed to mature streptokinase (mSka) upon incubation with full length SPase I, as demonstrated in lane 4. Fig. 5. HPLC analysis of the peptide substrate cleavage by full length SPase I and SPase37–204. The peptide substrate, KLTFGTVK PVQAIAGYEWL was incubated at 37 °Cfor2hwithfulllength SPase I (A), self-cleavage-generated SPase37–204 (B), or overex- pressed SPase37–204 (C). The cleavage of the peptide substrate was determined by HPLC using a Hewlett Packard Series 1100 system with a reversed-phase column (Vydac C18) as described under the Materials and methods. The peaks labeled 1, 2 and 3 correspond to the substrate, the C-terminal cleavage product and the N-terminal cleavage product, respectively. 3974 F. Zheng et al. (Eur. J. Biochem. 269) Ó FEBS 2002 the self-cleavage-generated and the overexpressed SPase37– 204, there was no product peak formed at the expected retention time in the HPLC profiles (Fig. 5B,C). The result was in accordance with that observed with the native substrate, prestreptokinase. Taken together, these results confirmed that S. pneumoniae SPase37–204, the major product of the self-cleavage lost its ability to cleave its substrates. Therefore, the self-cleavage of SPase I is believed to inactivate the activity of the enzyme. In vivo self-cleavage of S. pneumoniae SPase I As the in vitro self-cleavage inactivates the protease activity of S. pneumoniae SPase I, and this self-cleavage is actually stimulated, not protected by phospholipid, we are interested in exploring the reality of the self-cleavage within the bacterial cells. Polyclonal antibody against S. pneumoniae SPase I was obtained after immunization of rabbits with synthetic peptides. To detect SPase I and its cleavage within the bacterial cells, we performed a Western blot analysis on S. pneumoniae cells. The whole cell lysates were prepared from submerged cultures grown to different points through- out their exponential and stationary growth phases as indicated in Fig. 6A, separated on a SDS/polyacrylamide gel, and transferred to a PVDF membrane for immunode- tection with antidodies against S. pneumoniae SPase I and Era, an essential membrane associated GTP binding protein from S. pneumoniae [34]. As demonstrated in Fig. 6C, the full length S. pneumoniae SPase I and its cleaved product were detected in all the growth phases. This result confirmed for the first time that the self-cleavage of SPase I is indeed happening within the bacterial cells throughout all the growth phases. The cleaved product reacting with the peptide antibody against SPase I has a molecular mass of 11 kDa, equivalent to the molecular mass of peptides from residues 36–143, a possible self-cleaved product based upon self-cleavage sites identified. As expected, this protein band reacted specifically with both peptide antibodies against SPase I. It should be noted that the cell lysates were prepared immediately after harvest by adding SDS sample buffer and protease inhibitor cocktail, and boiling for 10 min to protect proteins from nonspecific proteolysis. S. pneumoniae cells maintain the full length SPase I in the highest level in exponential growth phase As demonstrated by Western blot analysis in Fig. 6C, S. pneumoniae cells appeared to produce the overall SPase I in the same level in all growth phases. However, differences in full length and cleaved SPase I were observed in different growth phases. In lag and stationary phases, the cells showed lower levels of full length SPase I and higher levels of cleaved product. In contrast, the cells had a higher level of full length protein and a lower level of cleaved product in exponential growth phase. In general, the bacterial cells maintained the active SPase I in the highest level in Fig. 6. Cell growth of S. pneumoniae and Western blot analysis of in vivo self-cleavage of S. pneumoniae SPase I. (A) Growth curve of S. pneumoniae cells. The cells were grown at 37 °C in BHI broth, and harvested at different time points as indicated. The cell growth was monitored by the measurement of absorbence at 620 nm. (B) Densitometer analysis of full length SPase I and the cleaved product in different growth phases. The analysis was performed based upon the results of Western blot analysis using a Personal Densitometer SI and IMAGE QUANT 5.0 software from Molecular Dynamics. The ratio of full length/cleaved SPase I was calculated based upon the relative intensity of the two protein bands reacting with antibody. (C) Western blot analysis of in vivo self-cleavage of SPase I. 20 lg of whole cell lysate from different growth phases was separated on a 4–20% SDS/polyacrylamide gel, and transferred to a PVDF membrane. Immunodetection was performed using immune serum against S. pneumoniae SPase I at 1 : 2000 dilution. Lanes 1–9 were the whole cell lysate prepared from S. pneumoniae R6 cells grown in BHI broth for different time as indicated. (D) Western blot analysis with Era antibody. Ó FEBS 2002 Self-cleavage of S. pneumoniae SPase I (Eur. J. Biochem. 269) 3975 exponential growth phase compared to lag and stationary growth phases. Densitometer analysis demonstrated that theratioofthefulllengthSPaseI/thecleavedSPaseIwas 0.81–1.0 in exponential phase, whereas the ratio was 0.36– 0.51 in lag phase and 0.39–0.55 in stationary phase (Fig. 6B). This result is very reproducible, Fig. 6C shows one example of several experiments. Clearly, a more quantitative methodology, other than Western blot analysis, needs to be developed to quantify the SPase I and its cleaved products more accurately. In addition, Western blot analysis with an antibody against S. pneumoniae Era demonstrated that approximately an equal amount of protein was loaded in each lane (Fig. 6D). The Era antibody was selected because of its equally expression in all the growth phases of S. pneumoniae. DISCUSSION A previous study demonstrated that S. pneumoniae SPase I catalyzes a self-cleavage. In the presence of phospholipid, the enzyme predominantly cleaves itself at one cleavage site between Gly36 and His37 [18]. In this study, we found that the self-cleavage occurred at multiple sites in the absence of phospholipid, and two additional self-cleavage sites, Ala65– His66 and Ala143–Phe144, were identified. All three self- cleavage sites strongly resemble the signal peptide cleavage site and follow the ()1, )3) rule for signal peptidase recognition. Phospholipid was demonstrated to stimulate the self-cleavage of S. pneumoniae SPase I. We also dem- onstrated that the major product of the self-cleavage, SPase37–204, totally lost its activity to cleave a native substrate prestreptokinase and a peptide substrate, indicat- ing that the self-cleavage inactivates the enzyme. More importantly, we found that the self-cleavage of S. pneumo- niae SPase I is also happening in vivo in all the growth phases, and that the bacterial cells maintain the active SPase I at the highest level in the exponential growth phase. These results suggest that the self-cleavage of SPase I may play an important role in regulating the activity of the enzyme within the cells. A number of genes encoding SPase I have been cloned and sequenced from both Gram-negative and Gram- positive bacteria including E. coli [9], Salmonella enterica serovar Typhimurium [35], Haemophilus influenzae [36], Staphylococcus aureus [37], Bacillus subtilis [38–40], S. pneu- moniae [18,28], and Streptomyces lividans [41]. To date, the in vitro biochemical studies on SPase I were performed using enzymes from three species, E. coli, S. pneumoniae, and Bacillus subtilis. Although significant differences in primary sequences exist, these three enzymes share a common biochemical property, i.e. in vitro self-cleavage. In E. coli, the self-cleavage of SPase I occurs between the residues Ala40 and Ala41, which are located in a hydro- philic domain connecting the two transmembrane segments at the N-terminus of the enzyme. Although the major product of this self-cleavage is still active, its specific activity is 100-fold less than the native enzyme [24]. In S. pneumo- niae, the purified full length SPase I catalyzes an intermo- lecular self-cleavage. The major product of this self-cleavage totally lost its activity as demonstrated in this study. In B. subtilis, the self-cleavage of SPase I (SipS) was observed recently, the soluble form of SipS that lacks the N-terminal membrane anchor is prone to self-cleavage, and the self-cleavage also results in complete inactivation of the enzyme [25]. Taken together, the self-cleavage was observed in all bacterial SPases investigated so far, suggesting that it is most likely a common biochemical property shared by bacterial SPases. Another common biochemical property is that the self-cleavage of the SPase I resulted in the complete lose or dramatic decrease of the enzymatic activity, implying that the self-cleavage, if occurring in vivo, may play an important role in the regulation of the enzymatic activity within the cells. Interestingly, phospholipid was demonstrated to affect self-cleavage of SPase I dramatically. In the absence of phospholipid, SPase I cleaves itself at multiple sites, whereas the self-cleavage predominantly occurs at one cleavage site in the presence of phospholipid. We believe that the interaction between SPase I and phospholipid somehow changes the conformation of the enzyme, and makes SPase I preferentially cleave itself at one specific site. More importantly, phospholipid was shown to stimulate the self- cleavage about 25-fold. This phospholipid stimulation was also observed for substrate cleavage of the SPase I [18]. Therefore, we believe that the interaction of SPase I and phospholipid may play an important role in the catalytic mechanism of the enzyme. Self-cleavage of the E. coli SPase I was previously described [24]. Scientists working on this enzyme specu- lated that the self-cleavage might be protected in vivo by the interaction of the enzyme with cytoplasmic membrane. Therefore, the possible physiological role of self-cleavage was basically ignored. However, our investigation revealed that the self-cleavage of S. pneumoniae SPase I was not protected by the phospholipid mixture from E. coli lipid extract. In contrast, the phospholipid mixture, which composed mainly of phosphatidylethanolamine, phosphat- idylglycerol, and cardiolipin, actually stimulated the self- cleavage of the S. pneumoniae SPase I. These results intrigued us to investigate the cleavage of S. pneumoniae SPase I in vivo.AsshowninFig.6C,Westernblot analysis demostrated that the self-cleavage of SPase I is indeed occuring in vivo in S. pneumoniae throughout all the growth phases. Although, at this moment, we can not conclusively explain why self-cleavage is happening in vivo, one speculation is that it may be involved in regulating the activity of the enzyme. It is not difficult to imagine that bacteria may secrete proteins at different levels at different growth phases and various conditions, and thus may require differential SPase I activity. Indeed, as we have shown in this study, S. pneumoniae cells maintain the full length SPase I in the highest level in exponential phase compared to lag and stationary growth phases. Bacterial cells in exponential phase secrete more proteins, therefore a higher level of SPase activity may be required for increasing the secretion capacity. It appears that the self-cleavage of SPase I may play a role in bacterial cells to control the overall activity of SPase I at a certain level. Further investigation to establish this hypothesis is needed. REFERENCES 1. Wickner, W., Driessen, A.J.M. & Hartl, F U. (1991) The enzymology of protein translocation across the Escherichia coli plasma membrane. Annu.Rev.Biochem.60, 101–124. 3976 F. Zheng et al. (Eur. J. Biochem. 269) Ó FEBS 2002 2. Dalbey, R.E., Lively, M.O., Bron, S. & van Dijl, J.M. (1997) The chemistry and enzymology of type I signal peptidase. Protein Sci. 6, 1129–1138. 3. Paetzel, M., Dalbey, R.E. & Strynadka, N.C.J. (2000) The struc- ture and mechanism of bacterial type I signal peptidases, a novel antibiotic target. Pharmacol. Therapeutics 87, 27–49. 4. Innis, M.A., Tokunaga, M., Williams, M.F., Loranger, J.M., Chang, S.Y. & Wu, H.C. (1984) Nucleotide sequence of the Escherichia coli prolipoprotein signal peptidase (lsp)gene.Proc. Natl Acad. Sci. U.S.A. 81, 3708–3712. 5. Driessen, J.A., Fekkes, P. & van der Wolk, J.P. (1998) The Sec system. Curr. Opin. Microbiol. 1, 216–222. 6. Economou, A. (1999) Following the leader: bacterial protein export through the Sec pathway. Trends Microbiol. 7, 315–320. 7. Moore, K.E. & Miura, S. (1987) A small hydrophobic domain anchors leader peptidase to the cytoplasmic membrane of Escherichia coli. J. Biol. Chem. 262, 8806–8813. 8. San Millan, J.L., Boyd, D., Dalbey, R.E., Wickner, W. & Beck- with, J. (1989) Use of phoA fusions to study the topology of Escherichia coli inner membrane protein leader peptidase. J. Bacteriol. 171, 5536–5541. 9. Wolfe, P.B., Wickner, W. & Goodman, J.M. (1983) Sequence of the leader peptidase gene of Escherichia coli and the orientation of leader peptidase in bacterial envelope. J. Biol. Chem. 258, 12073– 12080. 10. Dalbey, R.E. & Wickner, W. (1985) Leader peptidase catalyzes the release of exported proteins from the outer surface of the Escherichia coli plasma membrane. J. Biol. Chem. 260, 15925– 15931. 11. Fikes, J.D. & Bassford, P.J. (1987) Export of unprocessed pre- cursor maltose-binding protein to the periplasma of Escherichia coli cells. J. Bacteriol. 169, 2352–2359. 12. Koshland,D.,Sauer,T.T.&Botstein,D.(1982)Diverseeffectsof mutations in the signal sequence on the secretion of beta-lactamase in Salmonella typhimurium. Cell 30, 903–914. 13. Kuhn, A. & Wickner, B. (1985) Conserved residues of the leader peptide are essential for cleavage by leader peptidase. J. Biol. Chem. 260, 15914–15918. 14. Tschantz, W.R. & Dalbey, R.E. (1994) Bacterial leader peptidase I. Methods Enzymol. 244, 285–301. 15. Black, M.T. (1993) Evidence that the catalytic activity of pro- karyote leader peptidase depends upon the operation of a serine- lysine catalytic dyad. J. Bacteriol. 175, 4957–4961. 16. Tschantz, W.R., Sung, M., Delgado-Partin, V.M. & Dalbey, R.E. (1993) A serine and a lysine residue implicated in the catalytic mechanism of the Escherichia coli leader peptidase. J. Biol. Chem. 268, 27349–27354. 17. van Dijl, J.M., de Long, A., Venema, G. & Bron, S. (1995) Identification of the potential active site of the signal peptidase SipS of Bacillus subtilis. Structural and functional similarities with LexA-like proteases. J. Biol. Chem. 270, 3611–3618. 18.Peng,S.B.,Wang,L.,Moomaw,J.,Peery,R.B.,Sun,P.M., Johnson, R.B., Lu, J., Treadway, P., Skatrud, P.L. & Wang, Q.M. (2001) Biochemical characterization of signal peptidase I from Gram-positive Streptococcus pneumoniae. J. Bacterol. 183, 621–627. 19. Black, M.T., Munn, J.G.R. & Allsop, A. (1992) On the catalytic mechanism of prokaryotic leader peptidase I. Biochem. J. 282, 539–543. 20. Paetzel, M., Dalbey, R.E. & Strynadka, N.C.J. (1998) Crystal structure of a bacterial signal peptidase in complex with a beta- lactam inhibitor. Nature 396, 186–190. 21. Little, J.W. (1993) LexA cleavage and other self-processing reac- tions. J. Bacteriol. 175, 4943–4950. 22. Peat, T.S., Frank, E.G., McDonald, J.P., Levine, A.S., Woodgate, R. & Hendrickson, W.A. (1996) Structure of UmuD¢ protein and its regulation in response to DNA damage. Nature 380, 727–730. 23. Roland, K.L. & Little, J.W. (1990) Reactions of LexA repressor with diisopropyl fluorophosphate. A test of the serine protease model. J. Biol. Chem. 265, 12828–12835. 24. Talarico, T.L., Dev, I.K., Bassfort, P.J. & Ray, P.H. (1991) Inter- molecular degradation of signal peptidase I in vitro. Biochem. Biophys. Res. Commun. 181, 650–656. 25. van Roosmalen, M.L., Jongbloed, J.D.H., Kuipers, A., Venema, G., Bron, S. & van Dijl, J.M. (2000) A truncated soluble Bacillus signal peptidase produced in Escherichia coli is subject to self- cleavage at its active site. J. Bacteriol. 182, 5765–5770. 26. Huang, T.T., Malke, H. & Ferretti, J.J. (1989) The streptokinase gene of group A streptococci: cloning, expression in Escherichia coli, and sequence analysis. Mol. Microbiol. 3, 197–205. 27. Peng, S.B., Zheng, F., Angleton, E.L., Smiley, D., Carpenter, J. & Scott, J.E. (2001) Development of an internally quenched fluorescent substrate and a continuous fluorimetric assay for Streptococcus pneumoniae signal peptidase I. Anal. Biochem. 293, 88–95. 28. Zhang, Y., Greenberg, B. & Lacks, S.A. (1997) Analysis of a Streptococcus pneumoniae gene encoding signal peptidase I and overproduction of the enzyme. Gene 194, 249–255. 29. Studier, F.W., Rosenburg, A.H., Dunn, J.J. & Dubendorff, J.W. (1990) Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60–89. 30. Peng, S.B., Crider, B.P., Tsai, S.J., Xie, X.S. & Stone, D.K. (1996) Identification of a 14-Kda subunit associated with the catalytic sector of Clathrin-coated vesicle H+-ATPase. J. Biol. Chem. 271, 3324–3327. 31. von Heijne, G. (1983) Patterns of amino acids near signal- sequence cleavage sites. Eur. J. Biochem. 116, 17–21. 32. von Heijne, G. (1984) How signal sequences maintain cleavage specificity. J. Mol. Biol. 173, 143–251. 33. von Heijne, G. (1986) A new method for predicting signal sequence cleavage sites. Nucleic Acids Res. 14, 4683–4690. 34. Meier, T.I., Peery, R.B., Jaskunas, S.R. & Zhao, G. (1999) 16S rRNA is bound to Era of the Streptococcus pneumoniae. J. Bac- teriol. 181, 5242–5249. 35. van Dijl, J.M., van den Bergh, R., Reversma, T., Smith, H., Bron, S. & Venema, G. (1990) Molecular cloning of the Salmonella typhimurium lep gene in Escherichia coli. Mol. General Genet. 223, 233–240. 36. Fleischmann, R.D. et al. (1995) Whole genome random sequencing and assembly of Haemophilus influenzae. Science 269, 496–512. 37. Cregg, K.M., Wilding, E.I. & Black, M.T. (1996) Molecular cloning and expression of the spsB gene encoding an essential type I signal peptidase from Staphylococcus aureus. J. Bacteriol. 178, 5712–5718. 38. Meijer,W.J.J.,deJong,A.,Bea,G.,Wiseman,A.,Tjalsma,H., Venema, G., Bron, S. & van Dijl, J.M. (1995) The endogenous B. subtilis plasmids pTA1015 and pTA1040 contain signal pepti- dase-encoding genes. Identification of a new structural module on cryptic plasmids. Mol. Microbiol. 17, 621–631. 39. Tjalsma, H., Noback, M.A., Bron, S., Venema, G., Yamane, K. & van Dijl, J.M. (1997) Bacillus subtilis contains four closely related type I signal peptidase with overlapping substrate specificities. J. Biol. Chem. 272, 25983–25992. 40. van Dijl, J.M., de Jong, A., Vehmaanpera, J., Venema, G. & Bron, S. (1992) Signal peptidase I of B. subtilis: patterns of conserved amino acids in prokaryotic and eukaryotic type I signal pepti- dases. EMBO J. 11, 2819–2828. 41. Parro, V., Schacht, S., Anne, J. & Mellado, R.P. (1999) Four genes encoding different type I signal peptidase are organized in a cluster in Streptomyces lividans TK21. Microbiol. 145, 2255–2263. Ó FEBS 2002 Self-cleavage of S. pneumoniae SPase I (Eur. J. Biochem. 269) 3977 . In vitro and in vivo self-cleavage of Streptococcus pneumoniae signal peptidase I Feng Zheng, Eddie L. Angleton, Jin Lu and Sheng-Bin Peng Infectious. preprotein) with an N-terminal extension known as a signal (or leader) peptide. This signal sequence is involved in guiding the protein into the targeting and