Báo cáo khoa học: "Morphological variability of oaks (Quercus robur L, Quercus petraea (Matt) Liebl, Quercus pubescens Willd) in northeastern France: preliminary results" pptx

... ª 2009 FEBS Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster Herve ´ Colinet 1,2 , Siu Fai Lee 2 and Ary Hoffmann 2 1 Unite ´ d’E ´ cologie ... processes involve expression of some Hsps in Drosophila [40,57]. Finally, it has been suggested that expression of Hsps during...

Ngày tải lên: 06/03/2014, 09:22

... ACAGCAAAAAGGAGGCCAAA 138 BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 2 59 CD23 790 4 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707 095 ... 92 AL707 095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128 AK 095 731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 1 09 DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114 BC037851 CACAG...

Ngày tải lên: 06/03/2014, 22:21

... series of experiments was conducted to investigate the possible in uences of pyridine nucleotides on the propaga- tion activities of hamster-adapted scrapie agents 263K and 139A in vitro using normal ... large amount of NADPH is oxidized during the long incubation time in PMCA, it also will be interesting to know whether there is a competitive rela- tionship betwe...

Ngày tải lên: 07/03/2014, 03:20

... al. Crystal structure of L-aspDH from A. fulgidus FEBS Journal 274 (2007) 43154325 ê 2007 The Authors Journal compilation ª 2007 FEBS 4325 Crystal structure of archaeal highly thermostable L-aspartate ... 2007) doi:10.1111/j.1742-4658.2007.05961.x The crystal structure of the highly thermostable l-aspartate dehydrogenase (l-aspDH; EC 1.4.1.21) from the hyperth...

Ngày tải lên: 16/03/2014, 05:20

... TOC(0)(Beginning) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) 19 TOC(0)(End) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) 20 TOC(0)(Transition) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, ... Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese Kiyotaka Uchimoto † Chikashi Nobata † Atsushi Yamada † Satoshi Sekine ‡ Hitoshi Isahara † † Communicat...

Ngày tải lên: 17/03/2014, 06:20

... 2 that delineate the carbohydrate-binding cavity of the lectin protomer). A closer examination of the structure of the binding sites indicates that specificity of the Mora- ceae lectins is primarily ... monosaccharide-binding site. (B) Network of hydrogen bonds (dashes) anchoring Man to the amino acid residues of the monosaccharide-binding site of MornigaM. Stru...

Ngày tải lên: 30/03/2014, 20:20

... 4383 Acute activation of Erk1/Erk2 and protein kinase B/akt proceed by independent pathways in multiple cell types Doris Chiu, Kewei Ma, Alexander Scott and Vincent Duronio Department of Medicine, ... (1998) Involve- ment of guanosine triphosphatases and phospholipase C-gamma2 in extracellular signal-regulated kinase, c-Jun NH 2 -terminal kinase,...

Ngày tải lên: 30/03/2014, 20:20

... structure of accessory spleen in Chinese hamsters Yeo-Sung Yoon*, Jae-Won Shin 1 , Cheol-Beom Park, Yang-Seok Oh 2 , In- Se Lee, Heungshik S. Lee and Joon-Sup Lee College of Veterinary Medicine ... Center, College of Medicine, Hallym University, Chunchon 200-702, Korea To attempt a rigorous definition of the structure of the accessory spleen (AS) in the Chinese...

Ngày tải lên: 07/08/2014, 14:23

... The The PRNP gene in wild ruminants from Italy and Scotland 119 Fig. 2. The phylogenetic tree of similarity among the PRNP gene sequences of the analysed wild ruminants and other wild and domestic ungulates. ... mainland and 50 from the Isle of Rhum) and during the hunting seasons from Italy (n = 191). The chamois (n = 203) and ro...

Ngày tải lên: 07/08/2014, 23:22

... among groups. For the comparison between France and Central Europe, stan- dard errors of diversity parameters were based on the sampling of loci. Multivariate analyses (factorial analysis) based ... results of an investigation of the genetic variability of a scattered tree species, the wild service tree, Sorbus torminalis (L.) Crantz, based on an intensive sampling of p...

Ngày tải lên: 08/08/2014, 14:21

... Perring FH, eds). Bot Soc Br Isles, London, 27-50 Original article Morphological variability of oaks (Quercus robur L, Quercus petraea (Matt) Liebl, Quercus pubescens Willd) ... Q petraea at a regional scale (Lor- raine Plain), including Q pubescens. We studied inter- and intraspecific variations, and their link with ecological con...

Ngày tải lên: 08/08/2014, 19:21

... alt="" Original article The behavior of oaks in response to natural and induced exposure to the surfactant ABS S Moricca E Paoletti C Comparini 2 1 Istituto di Patologia e ... could increase the tolerance of succeeding generations of trees by selecting for pollen grains that are surfactant- tolerant. The alterations in the leaf...

Ngày tải lên: 08/08/2014, 19:21

... proportion of hybrid forms. RESULTS Of the investigated stands, 49% belonged to Q robur and 40% to Q petraea or con- sisted mainly of these species; 11 % of the stands were ... stand. Existing pedun- cles were also collected to test the result of the discriminant analysis. Afterwards the stands were divided into the following classes:...

Ngày tải lên: 08/08/2014, 19:21

... indigènes (Quercus robur L, Quercus petraea Liebl). Effet individuel, effet de l’appareil foliaire, des conditions climatiques et de l’âge de l’arbre F Huber INRA, station de recherches ... est de 35% contre 60% dans le bois adulte. Effet de la largeur de cerne sur la surface des vaisseaux du bois initial L’étu...

Ngày tải lên: 08/08/2014, 23:22

... properties measured in the 3 Original article Spatial variability of humus forms in some coastal forest ecosystems of British Columbia H Qian, K Klinka Forest Sciences Department, ... Computer Applications in Ore Evaluation. South African Institute of Mining and Metallurgy, Johannesburg Lowe LE, Klinka K (1981) Forest humus in the...

Ngày tải lên: 08/08/2014, 23:22