research report ''using the activity in pairs and in groups to teach writing in english''

Removal of arsenic from synthetic groundwater by adsorption using the combination of laterite and ironmodified activated carbon

... Technology, Vol. 6, No.1, 2008 - 43 - Removal of arsenic from synthetic groundwater by adsorption using the combination of laterite and iron-modified activated carbon Son Van Dang*, Junjiro ... of arsenic from synthetic groundwater using an adsorption column by sequential combination of laterite (LA) and iron-modified activated carbon (AC-Fe) as adsorbents. The effect of ratio LA/AC-Fe, ... by Langmuir isotherm and the adsorption capacities were 0.48mg/g and 1.18mg/g, respectively, as shown in the value of q0 of Langmuir isotherm. Figure 3 and Figure 4 are non-linear plots of...

REPORT ON THE OBSERVANCE OF STANDARDS AND CODES (ROSC) Cambodia docx

... cases of auditing standards, no modifications are made to the International Standards on Auditing. The National Accounting Council has adopted 15 accounting standards and 10 auditing standards. ... equivalent standard that conforms to International Standards on Quality Control, Cambodia Standards on Auditing cannot be regarded as conforming to the ISA.26 65. The environment in which the auditing ... 64. Cambodia Auditing Standards, which are based on International Standards on Auditing, are not up to date. Cambodia Standards on Auditing correspond to the version of ISA released by IFAC...

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC...

REPORT ON THE OBSERVANCE OF STANDARDS AND CODES (ROSC) doc

... part of a joint initiative of the World Bank and International Monetary Fund (IMF) to prepare Reports on the Observance of Standards and Codes (ROSC). The assessment focuses on the strengths and ... have the ultimate responsibility for the oversight of the approval and registration of statutory auditors and audit firms, the adoption of standards on ethics, internal quality control of audit ... Kazakhstan. The report uses International Financial Reporting Standards (IFRS) and International Standards on Auditing (ISA), and draws on international experience and good practices in the field of...

REPORT ON THE OBSERVANCE OF STANDARDS AND CODES (ROSC) potx

... delivery of lectures and for the acquisition and dissemination by these and other means of information connected with the profession and encourage the use of the recognized best methods of bookkeeping, ... profession; • Encourage and promote the study of the profession and arrange, provide, conduct, and supervise professional examinations, education, and training; • Issue members, on proof of ... standard of efficiency and professional conduct in the interests of the public generally and give concentrated expression to their opinions upon all questions and laws affecting the business of the...

Air Pollution Control in the Transportation Sector: Third Phase Research Report of the Urban Environmental Management Project pdf

... Kitamura for coordinating editing and printing of this large report. Professor Akio Morishima Acting Project Leader Urban Environmental Management Project Air Pollution Control in the Transportation ... explore the ways of bringing global environmental concerns into local environmental management in developing country cities in Asia. Air pollution control in the transportation sector, the title of ... Annexure II. Air Pollution Control in the Transportation Sector: Third Phase Research Report of the Urban Environmental Management Project Copyright © 2007 Institute for Global Environmental Strategies...

The relationships of forest and watershed characteristics to soil water retention, storm, runoff, erosion, and wave attenuation in vietnam

... storm runoff responses of 15 representative watersheds in Vietnam; and to determine peak discharge of these watersheds by the predictors of initial flow, rainfall, and rain intensity. c) to ... THE RELATIONSHIPS OF FOREST AND WATERSHED CHARACTERISTICS TO SOIL WATER RETENTION, STORM RUNOFF, EROSION, AND WAVE ATTENUATION IN VIETNAM SUMMARY OF DISSERTATION ... the others. The general objective of these chapters was to improve the understanding of the hydrological response to forests in the topographically and climatologically complex country of Vietnam. ...

báo cáo hóa học:" Research Article Using a State-Space Model and Location Analysis to Infer Time-Delayed Regulatory Networks" potx

... pagesdoi:10.1155/2009/484601 Research Article Using a State-Space Model and Location Analysis to Infer Time-Delayed Regulatory NetworksChushin Koh,1Fang-Xiang Wu,2, 3Gopalan Selvaraj,4 and Anthony J. Kusalik1, ... data. The tool has been demonstratedon artiﬁcial data and yeast cell-cycle gene-expression data. Using the yeast microarray data, we have illustrated that our model can help identify regulatory ... regulatory relationships and associating the regulatory time delay with every “parent-child” (i.e., regulator-target) pair [13]. The data set waspartitioned into parent set (the regulators) and...

Báo cáo hóa học: "Research Article On the Generalized Favard-Kantorovich and Favard-Durrmeyer Operators in Exponential Function Spaces" ppt

... by Ulrich AbelWe consider the Kantorovich- and the Durrmeyer-type modiﬁcations of the generalized Favard operators and we prove an inverse approximation theorem for functions f suchthat wσf ... Hindawi Publishing CorporationJournal of Inequalities and ApplicationsVolume 2007, Article ID 75142, 12 pagesdoi:10.1155/2007/75142Research Article On the Generalized Favard-Kantorovich and ... positive constant ϑ, Fnbecome the known Favard operators intro-duced by Favard [2]. Some approximation properties of the classical Favard operators forcontinuous functions f on R are presented in...

research report 'using the activity in pairs and in groups to teach writing in english'

... given and the procedure is repeated. - When the work has finished, the students open them and, in writing, join the fragments of information together to make it more interesting and logical. ... students to start writing immediately and dictate the beginning of the story to them. - After the dictation, each student adds up the story within two minutes. - When the first student has finished ... Ask the students to get into pairs. Give out copies of one text to half of the class and the other text to the half. - Ask them to list all the words in their text alphabetically. - Ask the...

Báo cáo lâm nghiệp: "Variations in seed and seedling responses to water stress in three provenances of Eucalyptus camaldulensis Dehnh" pptx

... relations of seedlings of twosubspecies of Eucalyptus globulus. Tree Phy-siol. 4, 129-138Variations in seed and seedling responses to water stress in three provenances of Eucalyptus ... between provenances in the production of hairs on the collar of ger-minating seedlings (Fig. 1 which bind theIII seedling firmly to the soil and assist early water uptake. ... that seeds and seed- lings of eucalypt species, subspecies and provenances within a species may differ in their germination and growth responses to water stress. Seeds from...

Xem thêm