Báo cáo sinh học: " Persistent expression of chemokine and chemokine receptor RNAs at primary and latent sites of herpes simplex virus 1 infection" pptx
Báo cáo y học: "ene expression analysis of human red blood cells"
... Jax, MD, PhD, Profil Institut für Stoffwechselforschung, Hellersbergstrasse 9, 414 61 Neuss, Germany. thomas.jax@profil-research.de. Tel: ++49 – 213 1 – 4 018 – 0; Fax. ++49 – 213 1 – 4 018 – 577 Received: ... with haematopoietic differentiation, immune regulation, and metabolism 1 . It was shown, that both the rate and extent of transcription in mature erythrocyte nuclei from c...
Ngày tải lên: 03/11/2012, 10:58
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... enrich- ment. Step Radical concentration (lmolÆmL )1 ) Recovery (%) Protein (mg) Specific activity (lmolÆmg )1 Æmin )1 ) Enrichment of R2F AS 0 .11 10 0 5525 14 .3 2.0 QS 0 .18 84 2 610 24.2 4.2 S 0. 31 61 640 41. 2 17 .2 MQ 0.52 52 2 91 69.0 36.0 1a 2a 3a 1b 2b 3b kDa 220 13 0 10 0 55 35 25 15 10 0 60 45 30 20 kDa Fig. ... 2.0022, one b- 1 H-hyperfine-ten- sor (1. 18, 1. 1...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... Influence of metal ions on human ACMSD I activity. Metal ion Concentration (m M) Relative activity (%) None – 10 0 Mg 2+ 1. 0 10 0 Mn 2+ 1. 0 10 0 Zn 2+ 0 .1 6 Ni 2+ 1. 0 10 0 Ca 2+ 1. 0 10 0 Fe 3+ 0 .1 15 Fe 2+ 0 .1 ... activity (unitsÆmg )1 ) Yield (%) Purification (-fold) Crude extract 305 1. 9 0.006 10 0 – Streptomycin sulfate 10 2 2.0 0. 019 10 0 3.26 Hydroxyhapatite 23...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... ACATCAAGGAGCGTTAGAATCTAA J2R 12 01 (with J1F and J2R) 10 long reverse GATTTAAGTGGAGCGGAATGCTA J3R 13 85 (with J1F and J3R) Real time PCR 11 short forward TGTGAAACGCAGTCTCTTCC H1F 12 2 (with H1F and H1R) 12 reverse ... between 1. 76 and 1. 86 [20, 21] Denaturation temperature (scanning rate ¼ 1 °CÆmin )1 ) No difference, identical at any scan rates and pH (e.g. 77.3 °...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... 10 0 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1 10 2 10 3 10 4 10 0 10 1...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... lyso- phosphatidic acid. Cell Signal 11 , 603– 610 . 12 Mattingly RR (19 99) Phosphorylation of serine 916 of Ras-GRF1 contributes to the activation of exchange factor activity by muscarinic receptors. ... for the stimulation of Ras-GRF1 activation by a G i -cou- pled pathway [12 ], Ca 2+ does not stimulate Ras-GRF1 phosphorylation at Ser 916 [14 ]. It is probable that Ras-GRF1 ca...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx
... proteins and are 6 13 times for chromatin- bound proteins (Fig. 1 and Table 1) . Using purified human Mcm proteins as a standard, it was calculated that approximately 1. 5–2.5 · 10 6 molecules of Mcm2, ... frequent and higher-level expression of Correspondence to Y. Ishimi, Mitsubishi Kagaku Institute of Life Sciences, 11 Minamiooya, Machida, Tokyo 19 4–8 511 , Japan. Fax...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo Y học: Regulated expression and intracellular localization of cystatin F in human U937 cells pptx
... differentiation was at hand for cystatin C. In contrast to the TPA experiment, the strong down-regulation of cystatin F expression by ATRA con- tradictthatC/EBPa is a major regulator of cystatin F expression ... 5505 Regulated expression and intracellular localization of cystatin F in human U937 cells Carl-Michael Nathanson 1 , Johan Wasse ´ lius 2 , Hanna Wallin 1 and M...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx
... GGGfiGCG 3¢-GTAGGTGTAGCGCCTGGTCTAG-5¢ Gly261Pro 5¢-CATCCACATCGGGGACCAGATC-3¢ GGGfiCCG 3¢-GTAGGTGTAGGGCCTGGTCTAG-5¢ Pro207Gly 5¢-GATTAATTATTATCCGCCATGCCC-3¢ CCGfiGGG 3¢-CTAATTAATAATACCCGGTACGGG-5¢ 413 6 F. Wellmann et al. ... reactions of medicinal and industrial relevance, and their spatial organization and mode of action are under investigation. The reactions are diverse, such as the...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot
... 769- 219 3, Japan Fax: + 81 87 894 018 1 Tel: + 81 87 894 511 1 ext. 6 513 E-mail: n-shimamoto@kph.bunri-u.ac.jp (Received 22 December 2 010 , revised 25 February 2 011 , accepted 22 March 2 011 ) doi :10 .11 11/ j .17 42-4658.2 011 .0 810 5.x We ... oxidative stress. Free Radic Res 39, 16 3 17 3. Regulation of BimEL expression by c-Fos Y. Ishihara et al. 18 80 FEBS Journal 278 (2 01...
Ngày tải lên: 06/03/2014, 00:21