A novel sonochemical synthesis of metal oxides based bhasmas

A novel sonochemical synthesis of metal oxides based bhasmas

A novel sonochemical synthesis of metal oxides based bhasmas

... presence of Pd, Cu and O atoms. 94 Inorganic Nanomedicine: Synthesis, Characterization and Application A Novel Sonochemical Synthesis of Metal Oxides Based Bhasmas S. Sivasankaran 1 ,a , S. Sankaranarayanan 2 , ... Sankaranarayanan 2 , S. Ramakrishnan 3 1 Department of Chemical Engineering, Manipal Institute of Technology, Manipal University, Manipal-576104, Kar...

Ngày tải lên: 11/06/2014, 12:29

9 255 0
Báo cáo khoa học: A novel transmembrane topology of presenilin based on reconciling experimental and computational evidence pptx

Báo cáo khoa học: A novel transmembrane topology of presenilin based on reconciling experimental and computational evidence pptx

... Chiesa R & Harris DA (1997) Evidence for a six-transmembrane domain structure of presenilin 1. J Biol Chem 272, 12047–12051. 24 Nakai T, Yamasaki A, Sakaguchi M, Kosaka K, Miha- ra K, Amaya ... Tomita T, Watabiki T, Takikawa R, Morohashi Y, Takasugi N, Kopan R, De Strooper B & Iwatsubo T (2001) The first proline of PALP motif at the C termi- nus of presenilins is obligatory fo...

Ngày tải lên: 23/03/2014, 13:20

7 458 0
Báo cáo hóa học: " A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials" pptx

Báo cáo hóa học: " A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials" pptx

... NANO EXPRESS Open Access A general strategy for synthesis of metal oxide nanoparticles attached on carbon nanomaterials Yi Zhao, Jiaxin Li, Chuxin Wu, Lunhui Guan * Abstract We report a general ... controlled manner. Here we present a unified strategy for synthesis of a large v ariety of NPs of metal oxides, including transition and rare earth metal oxides on SWNT...

Ngày tải lên: 21/06/2014, 06:20

5 355 1
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

... polymerase chain reaction. Med Sci Monit. 2001; 7: 345-9. 14. Ogawa Y, Itoh H, Nakagawa O, et al. Characterization of the 5'-flanking region and chromosomal assignment of the human brain natriuretic ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genom...

Ngày tải lên: 26/10/2012, 10:04

7 612 1
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... 5¢-AAGTAGGCGGAGTATCGAAC-3¢ (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense). Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCT ACTT-3¢ (antisense). Caspase 3 activity Cells ... intensity was determined using imagemaster 2d elite software 4.01 (Amersham Bioscience, Uppsala, Sweden). Statistical analysis Data in bar graphs are expressed as the me...

Ngày tải lên: 18/02/2014, 18:20

12 613 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG 5 1028 A. Ray et al. ... variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation Alpana Ray 1 , Srijita Dhar 1 , Arvind Shakya 1 , Papiya Ray 1 , Yasunori Okada 2 and Bimal K. Ray 1 1 Department of Vete...

Ngày tải lên: 07/03/2014, 02:20

11 439 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as the only open reading frame ... http://mips.gsf.de/proj/ yeast/info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATC...

Ngày tải lên: 07/03/2014, 15:20

8 485 0
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

... were analyzed manually and automatically by SEQUEST software. The acquisition and deconvolution of data were performed with the XCALI- BUR software on a Windows NT PC data system. Determination of ... were obtained from data bank and the abbreviations stand for: AaH, Androctonus australis Hector; Amm, Androctonus mauretanicus mauretanicus;Bj,Buthotus judaicus;Bot,Buthus occitanus tuneta...

Ngày tải lên: 07/03/2014, 16:20

9 534 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢. b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3 ¢. Cell survival and apoptosis analysis For viability ... the yeast two-hybrid assay and using a mammalian hybrid system (Invitrogen, Carlsbad, CA) (EDA Wheeler & V Ayyavoo, unpublished data). A blast search revealed that the IMAG...

Ngày tải lên: 07/03/2014, 21:20

12 561 0
Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc

Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc

... noisy fea- tures. In Proceedings of the Seventh Conference on Natural Language Learning (CoNLL-2003), page , Edmonton/Canada. Gloria V´azquez, Ana Fern´andez, Irene Castell´on, and M. Antonia Mart´ı. ... or grammatical function of the constituents, we have to take into account that the extraction is an approximation. There are various phenomena that can lead us to an erroneous extraction...

Ngày tải lên: 08/03/2014, 04:22

6 418 0
w