a novel approach for evolutionary synthesis of symbolic structures

a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

... However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... predominantly anatase TiO2 [9,22,23] DRUV–vis spectra of the as-anodized and annealed titania nanotubes are shown in Fig 10 It can be seen that the titania nanotubes annealed under N2 atmosphere...

Ngày tải lên: 05/05/2014, 15:26

8 634 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

... high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, such as of edge and corner ... decomposition applications of Co-Precipitation in the absence and presence nanosized metal oxides such as AP-MgO, AP- of Polyvinylpyrrolidone (PVP) as a capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15­ agent ... decomposition of the final temperature (for min); the temperature 2-CEPS was increased at rate of 20 oC/ for 13 Also, detector temperature was 230 oC Experimental Materials Synthesis of CaO nanoparticles...

Ngày tải lên: 06/05/2014, 08:55

12 705 0
Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

... Surface area of the catalyst before and after use in the reaction was measured using surface area & pore size analyzer (NOVA 1000e, Quanta chrome Instruments) All the chemicals were used as-received ... Recent advances of bismuth (III) salts in organic chemistry: application to the synthesis of aliphatics, alicyclics, aromatics, amino acids and peptides, terpenes and steroids of pharmaceutical interest ... [6], amines [7], and synthesis of azaheterocycles [8] are some of the synthetic applications of oximes They are also useful for selective a- activation [9] and are extensively used as intermediates...

Ngày tải lên: 20/06/2014, 22:20

6 591 1
Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

... codon)-3’ and the “second round PCR” (one -for- all) primer set: One -for- all-forward: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3’ and One -for- all-reverse: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3’ PCR products containing ... in large scale as described by Soutscheck et al [12], rearranged in line assay format and validated with a number of pre-characterized serum samples These validation data confirmed the seroreactivity ... assays, data analysis and Page of wrote the manuscript KIP carried out large scale protein purification, microarray screen, line development and data analysis, participated in the coordination of the...

Ngày tải lên: 12/08/2014, 04:20

9 750 0
Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx

Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx

... augment the detection process We are not alone in this vision, as others have also adopted this strategy as a way forward in molecular analysis Alagaratnam et al are utilising Bayesian approaches ... 17(5):323-329 Ito M, Nakamura F, Baba A, Tamada K, Ushijima H, Lau KHA, Manna A, Knoll W: Enhancement of surface plasmon resonance signals by gold nanoparticles on high-density DNA microarrays J Phys Chem ... 51(12):2333-2340 Okamoto M, Kawabe T, Iwasaki Y, Hara T, Hashimoto N, Imaizumi K, Hasegawa Y, Shimokata K: Evaluation of interferon-gamma, interferon-gamma-inducing cytokines, and interferongamma-inducible...

Ngày tải lên: 12/08/2014, 14:20

17 377 0
Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc

Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc

... creatinine [CR] and urea [UR]) or liver dysfunction (alanine aminotransferase [ALT], aspartate aminotransferase [AST], gamma-glutamyl transpeptidase [GGT], total and conjugated bilirubin, alkaline ... the total amount of available data Variable selection for the MLR model In the MLR model also, the variable selection was performed with a forward, a backward, and a stepwise algorithm for simple ... input variables Background Hospital information systems in intensive care medicine generate large datasets on a daily basis These rapidly increasing amounts of data make the task of extracting...

Ngày tải lên: 13/08/2014, 08:20

7 318 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... (lane 3) Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was and lg for placenta (lanes ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...

Ngày tải lên: 23/03/2014, 13:20

11 475 0
Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

... of each substrate linkages of blood group A and B antigens, Gala1-4Galb14GlcNAc and GlcNAca1-4Galb1-4GalNAc, and GlcAb13Galb1-3Gal structures, respectively The structure of the site of cleavage ... indicating that it is very useful as a substrate instead of keratan sulfate for analytical use in the endob-galactosidase assay In addition, this similarity in the values of Vmax/Km suggests that ... ESI-MS analyses revealed that is a pentasaccharide b-glycoside, GlcNAcb1-3Galb1-4GlcNAcb1-3Galb1-4GlcNAcb-pNP Peak A was also subjected to ESI-MS analysis The molecular mass of peak A was estimated...

Ngày tải lên: 31/03/2014, 07:20

11 365 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... 85(3):221-228 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... human bone marrow Proc Natl Acad Sci USA 2000, 97(7):3213-3218 Kawada H, Fujita J, Kinjo K, Matsuzaki Y, Tsuma M, Miyatake H, Muguruma Y, Tsuboi K, Itabashi Y, Ikeda Y, Ogawa S, Okano H, Hotta ... immediately after an acute myocardial infarction (AMI) subjected to standard pharmacological therapy Cell Characterization For the immunophenotype, bone marrow and BM-MNC cells were stained in quadruplicate...

Ngày tải lên: 18/06/2014, 15:20

9 773 0
Báo cáo hóa học: "Research Article A Decentralized Approach for Nonlinear Prediction of Time Series Data in Sensor Networks" pptx

Báo cáo hóa học: "Research Article A Decentralized Approach for Nonlinear Prediction of Time Series Data in Sensor Networks" pptx

... lack of real system deployments and available data experiments Researchers often evaluate their algorithms and protocols with model-driven data [38] Here, we consider a classical application of ... other hand, a small value for ν will result in a large model order This will lead to a small approximation error, at the price of high computational load for updating the model at each sensor, and ... some abuse of notation Radial kernels have a natural interpretation in terms of measure of similarity in X, as the kernel value is larger the closer together two locations are Two typical examples...

Ngày tải lên: 21/06/2014, 17:20

12 531 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

... EURASIP Journal on Advances in Signal Processing delay can always be obtained that ranges below the group delay of a corresponding LP FIR filter However, the absolute minimum value of the passband ... group delay was of no concern In contrast, for instance, Lang [14] has shown that his algorithms for the constrained design of digital filters with arbitrary magnitude and phase responses have the ... minimizes aliasing and imaging The demand for low group delay particularly of the AFB prototype filters has not been asked for explicitly Based on the algorithm [15] the approach [16] introduces additional...

Ngày tải lên: 21/06/2014, 19:20

13 623 0
Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot

Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot

... For each position of the light source an image is captured, thus obtaining a set of images as observations If a Lambertian surface is assumed, the image irradiance equation relating the surface ... gradients, and the blur parameter 6.1 Data fitting term Since, we have many observations of the same stationary object captured with a stationary camera, the data fitting term (from (3)) can be written as ... reached It may be mentioned here that p, q are all matrices γm and τm are real values corresponding to a particular source position and σ is also a real value As already mentioned, we use the albedo...

Ngày tải lên: 21/06/2014, 22:20

12 379 0
Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx

Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx

... mg catalyst was put into the quartz tube The temperature was raised to the setting value in Ar atmosphere at a flow rate of 200 mL/min before CH4 was introduced into the reactor at 60 mL/min for ... spectrophotometer at room temperature and in a backscattering geometry, with Ar laser at 514.5 nm Results and Discussion Figure shows the Raman spectra for materials grown at different growth temperature (a: ... even diameters and appear clean and uncoated It is well known that when the diameter distribution of SWCNTs is more narrow, the application values of SWCNTs are higher At this growth temperature,...

Ngày tải lên: 22/06/2014, 00:20

4 395 0
Báo cáo hóa học: " A Versatile Route for the Synthesis of Nickel Oxide Nanostructures Without Organics at Low Temperature" doc

Báo cáo hóa học: " A Versatile Route for the Synthesis of Nickel Oxide Nanostructures Without Organics at Low Temperature" doc

... non-toxic, and mass production route for the synthesis of other functional oxide materials Experimental Preparation of NiO Nanostructures In a typical synthesis, appropriate amount of nickel powder was ... 1b) The diameters of the nanoparticles are in the range of 50–70 nm with an average diameter of 60 nm Using higher reaction time of 24 h, the average diameter of the nanoparticles increased from ... EDX measurement indicates that nanoparticles are composed of Ni and O, and the analysis in the NiO nanoparticles/nanoflowers indicates an atomic ratio of 86% Ni and 14% O, which is very near to...

Ngày tải lên: 22/06/2014, 01:20

5 526 0
Báo cáo hóa học: "A UNIFYING APPROACH FOR CERTAIN CLASS OF MAXIMAL FUNCTIONS" pot

Báo cáo hóa học: "A UNIFYING APPROACH FOR CERTAIN CLASS OF MAXIMAL FUNCTIONS" pot

... (3.5) We may assume that P does not contain |x|d+1 as one of its terms By dilation invariance, we may also assume that a = |α|=d+1 (3.6) A unifying approach for certain class of maximal functions ... Journal of the Mathematical Society of Japan (1951), 296–305 Ahmad Al-Salman: Department of Mathematics, Faculty of Science, Yarmouk University, Irbid, Jordan E-mail address: alsalman@yu.edu.jo ... coefficients of the polynomial P A special class of radial weights that have received a considerable amount of attention is the class of power weights |x|α For background information and related results...

Ngày tải lên: 22/06/2014, 22:20

17 334 0
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx

Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx

... 5′-TGA-CTC-TAA-GTG-GCATTC-AAG-G (sense) and 5′-GAT-TCA-GAC-ATC-TCTTCT-CAC-CC (antisense) for IP-10 [24], and 5′-GTG-GGG-CGC-CCC-AGG-CAC-CA (sense) and 5′-CTC-CTT-AAT-GTC-ACG-CAC-GAT-TTC (antisense) for ... significant stimulatory or inhibitory effects were observed (Fig 3) Statistical analysis R76 Data were analyzed on a Power Macintosh computer using a statistical software package (Statview 4.5; Abacus ... classification of rheumatoid arthritis Arthritis Rheum 1988, 31:315-324 21 Iwabuchi H, Kasama T, Hanaoka R, Miwa Y, Hatano Y, Kobayashi K, Mori Y, Negishi M, Ide H, Adachi M: Down-regulation of...

Ngày tải lên: 09/08/2014, 01:21

8 446 0
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

... Kubota K, Makuuchi M, Kusaka K, Kobayashi T, Miki K, Hasegawa K, Harihara Y, Takayama T: Measurement of liver volume and hepatic functional reserve as a guide to decision-making in resectional ... colorectal liver metastases Am J Surg 2003, 185:221-229 Kawasaki S, Makuuchi M, Kakazu T, Miyagawa S, Takayama T, Kosuge T, Sugihara K, Moriya Y: Resection for multiple metastatic liver tumors after ... Crosby JA, Catton CN, Davis A, Couture J, O'Sullivan B, Kandel R, Swallow CJ: Malignant gastrointestinal stromal tumors of the small intestine: a review of 50 cases from a prospective database Ann...

Ngày tải lên: 09/08/2014, 07:21

4 454 0
Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc

Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc

... the CHD and that of the DHD Correlation 4: translation and access of biological information via the DNA transcription machinery One of the limitations of the Central Dogma (and, for that matter, ... of eukaryotic DNA, does not appear to participate in the “classic” Watson and Crick role of DNA as an information repository for protein synthesis; therefore the majority of human DNA appears to ... Drosophila genome Data from Drosophila suggest that static domains form as the result of additional compartmentalization of chromatin that can function as insulators, which can have a further...

Ngày tải lên: 13/08/2014, 16:20

29 420 0
Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps

Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps

... significant clinical benefits like disease stability in 80% of patients after 2–3 doses of vaccine The mean survival rate was 13 months for melanoma patients and months for renal cell carcinoma patients ... hormone-refractory metastatic disease Prostate 1999, 38:73-8 Callegari-Jacques SM, Grattapaglia D, Salzano FM, Salamoni SP, Crossetti SG, Ferreira ME, Hutz MH: Historical genetics: spatiotemporal analysis ... CR, Partin AW, Eisenberger MA, Chan DW, Pearson JD, Walsh PC: Natural history of progression after PSA elevation following radical prostatectomy JAMA 1999, 281(17):1642-5 Hadaschik BA, Gleave...

Ngày tải lên: 14/08/2014, 19:22

7 363 0
Xem thêm
w