Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt

Tài liệu Báo cáo khoa học: ¨ Induction of Kruppel-like factor 4 by high-density lipoproteins promotes the expression of scavenger receptor class B type I pptx

Tài liệu Báo cáo khoa học: ¨ Induction of Kruppel-like factor 4 by high-density lipoproteins promotes the expression of scavenger receptor class B type I pptx

... of KLF4 mRNA is most abundant in the colon and skin in mice, whereas expression of KLF4 is decreased in intestinal adeno- mas of multiple intestinal neoplasia mice and in colo- nic adenomas of ... cell adhesion to the endothelial surface and prolongation of clotting time following the induc- tion of KLF4 under in ammatory states, and implicat- ing KLF4 as a...
Ngày tải lên : 18/02/2014, 04:20
  • 9
  • 516
  • 0
Tài liệu Báo cáo khoa học: Induction of uPA gene expression by the blockage of E-cadherin via Src- and Shc-dependent Erk signaling docx

Tài liệu Báo cáo khoa học: Induction of uPA gene expression by the blockage of E-cadherin via Src- and Shc-dependent Erk signaling docx

... interaction of its extracellular domain [3]. Proteins such as p120-catenin, a- catenin and b-catenin assemble the cytoplasmic cell adhesion complex (CCC) on its intracellular domain and link E-cadherin indirectly ... compilation ª 2006 FEBS 237 domain), 5¢-CUACUUGGUUCGGUACAUGGG-3¢ and 5¢-CAUGUACCGAACCAAGUAGGA-3¢; control siRNA 5¢-GUACCUGACUAGUCGCAGAAG-3¢ and 5¢-UCUG CGACUAGUCAGGUACGG...
Ngày tải lên : 19/02/2014, 05:20
  • 14
  • 599
  • 0
Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt

Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt

... significance of the element located in the 4G ⁄ 5G site of the PAI-1 promoter in the TNFa sti- mulation of PAI-1 expression in endothelial cells. PAI-1 expression was monitored at: (a) the level of ... NF-jB. Results Upregulation of PAI-1 expression in endothelial cells by ROS In preliminary experiments, we evaluated the role of RO...
Ngày tải lên : 30/03/2014, 11:20
  • 11
  • 393
  • 0
Báo cáo khoa học: Induction of PPARb and prostacyclin (PGI2) synthesis by Raf signaling: failure of PGI2 to activate PPARb potx

Báo cáo khoa học: Induction of PPARb and prostacyclin (PGI2) synthesis by Raf signaling: failure of PGI2 to activate PPARb potx

... ¢; PPARb forward, 5¢—AAGAGGAGAAAGAGGAAG TGG—3¢; PPARb reverse, 5¢—ATTGAGGAAGAGGCTG CTGA—3¢; actin forward, 5¢—GATGATGATATCGCCGC GCTCGTCGTC—3¢; actin reverse, 5¢—GTGCCTCAGGG CAGCGGACCGCTCA—3¢. Quantitative ... PPARb induction in the presence of UO126 or actinomycin D. Shown is a quantitative evaluation of a northern blot by PhosphorImaging. Fig. 4. Induction of PPARb tran...
Ngày tải lên : 07/03/2014, 12:20
  • 10
  • 434
  • 0
Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx

Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx

... pro- vides a mechanism by which this protein can affect the actin cytoskeleton. PtdIns(4,5)P2 plays an important role in the attachment of the cytoskeleton to the plasma membrane as well as affecting actin ... presence of peptide. This is probably a result of the peptide partitioning more favorably into the liquid-crystalline phase than into the gel phase. In a...
Ngày tải lên : 07/03/2014, 17:20
  • 12
  • 369
  • 0
Báo cáo khoa học: Induction of translationally controlled tumor protein (TCTP) by transcriptional and post-transcriptional mechanisms pot

Báo cáo khoa học: Induction of translationally controlled tumor protein (TCTP) by transcriptional and post-transcriptional mechanisms pot

... IgE-dependent histamine-releasing factor. Science 269, 688–690. 14 Bheeka-Escura R, MacGlashan DW, Langdon JM & MacDonald SM (2000) Human recombinant histamine- releasing factor activates human eosinophils ... Total RNA was extracted at each time point, and TCTP mRNA was analyzed by northern blotting and quantified by scanning using SCION IMAGE software. TCTP mRNA levels were normal...
Ngày tải lên : 16/03/2014, 05:20
  • 9
  • 374
  • 0
Báo cáo Y học: Induction of chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI ) gene expression is mediated by ETS factor binding sites doc

Báo cáo Y học: Induction of chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI ) gene expression is mediated by ETS factor binding sites doc

... ETS TTCCTGT GACTGACTTGTCCGCACTAACAGCCGCCCCACAACAATATGAGGAGTTACAAATGCTTTATTAATAATCATT Nkx2. Nxk2. GAAGCATTGTTTGGAGTTTGAGCATCCTGGGAATAAAAATGATGAAAAAGGAAAAAGAGGATTGATTGGAAAGTTTAT TTTAAGATCATCTTTGGGATGAATAGGAATCATCGATTCGGATCGAATTTGTGGCAGTAGCTGCAGTTTCATGTGTGTG ... Nxk2. GAAGCATTGTTTGGAGTTTGAGCATCCTGGGAATAAAAATGATGAAAAAGGAAAAAGAGGATTGATTGGAAAGTTTAT TTTAAGATCATCTTTGGGATGAATAGGAATCATCGATTCGGATCGAATT...
Ngày tải lên : 17/03/2014, 17:20
  • 9
  • 360
  • 0
Báo cáo khoa học: Control of transferrin expression by b-amyloid through the CP2 transcription factor pdf

Báo cáo khoa học: Control of transferrin expression by b-amyloid through the CP2 transcription factor pdf

... : TCCTCGGACTCGAGTCGCCCCGTCCTTCTCCCTCGTCGAGGAGGCACCCCCTGGAAACTCTCGGGTCCTCGTCCT AAAGCTCCCTGTGGACCACCCCTC GTTTTCCACGACTCAGACAGAAACTGGAACTCGGGTCGAACAAAGAGGACG TAGGAGGGGGTTTTCCC CGAAACGGACAGTAAGACGTCAAGATCACACCCCAGACCCGCGTCAAGAAAAGGGAGA GGTCGGAGCCTCAGAAGGAGACACCTGAC GCGTCTATCCTGACCACCGTGCCTGGTCGAGACGTCGGGACCTCAG TCCTCGTCTCGGGGGGCCGAGGGTCGGGCGGCATCGGC GAGGACCGTGGCTCGCTCGGCGCTACTGTTACCGACG TAACACGAA...
Ngày tải lên : 23/03/2014, 03:20
  • 12
  • 371
  • 0
Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deficiency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx

Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deficiency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx

... ultrasonography would have been a better clinical marker and may have provided more reliable information. In summary, increased visceral adiposity is associ- ated with increased proinflammatory factors ... organ, which increases the production of in ammatory cytokines (e.g. IL-6, TNFa) as well as lipoprotein lipase, angiotensinogen, free fatty acids, resistin, leptin, lactate, PAI-...
Ngày tải lên : 18/02/2014, 06:20
  • 13
  • 662
  • 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

... partner, the RXR, and are subject to cross-talk interactions with other nuclear recep- tors and with a broad range of other intracellular signaling pathways, including those activated by certain ... transformation of preg into androstadienol, a precursor in the biosynthesis of Fig. 5. In uence of increasing concentrations of cyt b 5 on the relative formation of andr...
Ngày tải lên : 08/03/2014, 08:20
  • 7
  • 612
  • 0

Xem thêm