Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt

Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site Maria Swiatkowska1, Janusz Szemraj2 and Czeslaw S Cierniewski1,3 Department of Molecular and Medical Biophysics, Medical University in Lodz, Poland Department of Biochemistry, Medical University in Lodz, Poland Center of Medical Biology, Polish Academy of Sciences, Lodz, Poland Keywords antioxidants; endothelium; gene regulation; inflammation; reactive oxygen species Correspondence C S Cierniewski, Department of Medical and Molecular Biophysics, Medical University in Lodz, ⁄ Mazowiecka Street, 92-213 Lodz, Poland Tel: +48 42 678 3393 E-mail: cciern@zdn.am.lodz.pl (Received 25 April 2005, revised September 2005, accepted 16 September 2005) doi:10.1111/j.1742-4658.2005.04979.x Plasminogen activator inhibitor type (PAI-1) is induced by many proinflammatory and pro-oxidant factors Among them, tumor necrosis factor a (TNFa), a pivotal early mediator that regulates and amplifies the development of inflammation, is one of the strongest PAI-1 synthesis activators Location of the TNFa response element in the PAI-1 promoter is still ambiguous In this study, we attempted to evaluate the significance of the element located in the 4G ⁄ 5G site of the PAI-1 promoter in the TNFa stimulation of PAI-1 expression in endothelial cells PAI-1 expression was monitored at: (a) the level of mRNA using real-time PCR, (b) PAI-1 gene transcription by transfection reporter assays, and (c) protein synthesis using the enzyme immunoassay NF-jB activity was monitored using the electrophoretic mobility shift assay Its activity was modified by either antisense oligonucleotides or transfection of endothelial cells with the wild-type or mutated IjBa We have shown that TNFa-induced expression and gene transcription of PAI-1 involves a regulatory region present in segment )664 ⁄ )680 of the PAI-1 promoter This reaction involves the TNFainduced generation of superoxide leading to activation of NF-jB, and can be abolished by antioxidants and by overexpression of a super-suppressor phosphorylation-resistant IjBa Stimulation of PAI-1 under these conditions involves the motif of the PAI-1 promoter adjacent to the 4G ⁄ 5G site, which can directly interact with NF-jB We show that activation of PAI-1 gene by TNFa and reactive oxygen species is mediated by interaction of NF-jB with the cis-acting element located in the )675 4G ⁄ 5G insertion ⁄ deletion in the PAI-1 promoter Plasminogen activator inhibitor type-1 (PAI-1) is mainly identified as the primary physiological inhibitor of both urokinase-type (uPA) and tissue-type (tPA) plasminogen activators, and plays an important role in regulation of the fibrinolytic system Under normal conditions, PAI-1 is present in plasma at low concentrations, although high levels are seen in a variety of clinical settings [1] PAI-1 is an early response gene product known to be activated by numerous factors, including transforming growth factor b (TGFb) and interleukin (IL)-1b [2], platelet-derived growth factor and b fibroblast growth factor [3], thrombin [4], Abbreviations DCF, dichlorofluorescin; DCFH-DA, 2¢7¢-dichlorofluorescein diacetate; EMSA, electrophoretic mobility shift assay; H2O2, hydrogen peroxide; HUVEC, human umbilical vein endothelial cells; IKK, IjB kinase; IL, interleukin; NAC, N-acetylcysteine; O2–, superoxide anion; PAI-1, plasminogen activator inhibitor-1; PEG, poly(ethylene glycol); ROS, reactive oxygen species; TGFb, transforming growth factor b; TNFa, tumor necrosis factor a FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS 5821 The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al tumor necrosis factor a (TNFa) [5], insulin [6], angiotensin II [7] and oxidation products [8] PAI-1 is inherently unstable and readily converts from an active to a latent form [9,10] Thus, self-inactivation of PAI-1 is a crucial regulatory mechanism, by which this protein functions in circulation Another mechanism of PAI-1 regulation results from the transcriptional control of its expression Several regulatory elements have been localized in the human PAI-1 promoter and include two Sp1 elements ()73 and )42 bp) mediating glucose responsiveness [11], a hypoxia-responsive element ()194 bp) [12], a very lowdensity lipoprotein-responsive site ()672 ⁄ )657 bp) [13], SMAD and -4 protein-binding sites that mediate TGFb responsiveness ()730, )580, and )280 bp) [14], oxidative stress and thymosin b4 responsive AP-1 site at )60 ⁄ 52 [15,16], and a 5¢ distal TNFa responsive enhancer of the PAI-1 gene located 15 kb upstream of the transcription start site containing a conserved NF-jB-binding site [17] In this report, we provide evidence that activation of PAI-1 gene by TNFa and reactive oxygen species (ROS) is mediated by interaction of NF-jB with the cis-acting element located in the )675 4G ⁄ 5G insertion ⁄ deletion in the PAI-1 promoter Because TNFa is a pivotal early mediator that regulates and amplifies the development of inflammation, this mechanism can be used primarily under diverse inflammatory conditions, including ischemia, traumatic injury, allograft rejection, cytokine stimulation and activation by bacterial components [18,19] TNFa is known to induce the generation of ROS [20], which constitute primary signals transduced into the cytoplasm and ultimately alter the expression of specific genes [21–23] Because ligand-stimulated NF-jB activation can be blocked by antioxidants, it appears that the generation of ROS may be involved in the induction of PAI-1 expression by TNFa via the activation of NF-jB Results Upregulation of PAI-1 expression in endothelial cells by ROS In preliminary experiments, we evaluated the role of ROS during the stimulation of PAI-1 expression in endothelial cells by TNFa For this purpose, endothelial cells were treated with 10 mm N-acetylcysteine (NAC) for 30 min, followed by incubation with TNFa (50 ngỈmL)1) and the released PAI-1 antigen was determined by ELISA Figure 1A shows that the treatment of endothelial cells with TNFa increased PAI-1 antigen by almost twofold (180 ± 10%, P < 0.05) Cotreat5822 A B Fig Effect of TNFa and H2O2 on PAI-1 expression in vascular endothelial cells Expression of PAI-1 was analyzed at the level of protein synthesis (A) in the presence or absence of NAC (10 mM) The PAI-1 antigen was determined using the ELISA test (B) PAI-1 mRNA expression analyzed by real-time PCR in endothelial cells induced by TNFa in the absence or presence of different antioxidants For this purpose, endothelial cells were preincubated for 30 with NAC (10 mM), catalase (500 mL)1), pyrrolidine dithiocarbamate (PDTC) (100 lM), or vitamin C (100 lM) and stimulated with TNFa (50 ngỈmL)1) for h Data are shown as mean ± SD obtained during three separate experiments ment with NAC inhibited TNFa-induced PAI-1 antigen accumulation by 48 ± 7% (P < 0.05) Similarly, incubation of endothelial cells with 100 or 200 lm H2O2 for 30 increased PAI-1 by 160 ± and 180 ± 8%, respectively (P < 0.05 for both) Also, in this case, cotreatment with NAC inhibited H2O2induced PAI-1 antigen release by 38 ± and 26 ± 3% observed at 100 and 200 lm H2O2, respectively (P < 0.05 for both) FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al To determine whether the changes in PAI-1 antigen release were due to modulation of PAI-1 mRNA expression, we performed real-time PCR using endothelial cells treated with TNFa in the presence or absence of NAC In addition to NAC, other antioxidants, such as PDTC (100 lm), catalase (500 mL)1) or vitamin C (100 lm) attenuated TNFa-induced PAI-1 mRNA expression (Fig 1B) NF-jB regulates PAI-1 gene transcription Under basal culture conditions, endothelial cells exhibit little or no dichlorofluorescin (DCF) fluorescence Treatment for 10 with TNFa used at 50 ngỈmL)1 increased DCF fluorescence, which was attenuated by cotreatment with NAC (10 mm) (Fig 2A,B) Similarly, incubation of endothelial cells with 100 lm H2O2 for 10 increased DCF fluorescence, which was then suppressed by cotreatment with NAC These findings indicate that both TNFa and H2O2 increased intracellular oxidative stress, which was then partially abolished by the antioxidant NAC Figure 2C shows the effect of poly(ethylene glycol) (PEG) and PEG-catalase on endothelial cells stimulated with TNFa Results were obtained after h of TNFa stimulation in the presence of PEG alone or PEG-catalase (100–1000 mL)1) Experiments were performed three times with similar results To determine whether TNFa-induced PAI-1 expression involves the activation of NF-jB, we performed electrophoretic mobility shift assay (EMSA) studies using the consensus oligonucleotide for NF-jB (Fig 3A), and PCR product containing wild-type sequence from )664 to )680 of PAI-1 promoter (Fig 3B), 17-bp fragment ()664 to )680) of the PAI-1 promoter containing the putative jB-binding site (Fig 3C) [24] The treatment of endothelial cells with TNFa or H2O2 resulted in NF-jB activation which was inhibited in competition experiment using either the jB consensus oligonucleotide or fragment )664 to )680 of PAI-1 promoter containing the jB-binding site but not by mutated fragment )664 to )680 of PAI-1 promoter NAC abolished NF-jB activation, indicating that TNFa- and H2O2-induced activation of NF-jB involves the generation of ROS The identity of NF-jB present in the nuclear complex formed with the NF-jB consensus oligonucleotide was proved by supershift produced with anti-p65 sera (Fig 3C) The effect of oxidative stress-induced NF-jB activation in TNFa-activated cells was confirmed using an antioxidant NAC The cells were transfected with pNF-jBSEAP plasmid and treated with TNFa in the presence or absence of NAC NF-jB promoter activation by TNFa was inhibited by antioxidant, NAC (Fig 3D) To confirm the role of fragment ()664 to )680) of PAI-1 promoter in this reaction, endothelial cells were analyzed after transfection with either wild-type PAI-1 promoter or its mutated version Mutation of the NF-jB putative binding site within the PAI-1 promoter abolished its sensitivity to induction by TNFa (Fig 3E) To further evidence whether NF-jB activation is required for TNFa- and H2O2-induced PAI-1 expression, in subsequent experiments NF-jB expression was downregulated with antisense oligodeoxynucleotide (5¢-GGGGAACAGTTCGTCCATGGC-3¢) that is specific to the NF-jB subunit, RelA p65 In parallel, endothelial cells incubated with sense oligonucleotide were used as a control In contrast to the sense RelA oligonucleotide, the addition of the antisense RelA oligonucleotide to endothelial cells resulted in strong inhibition of both TNFa- and H2O2-induced PAI-1 mRNA expression (Fig 4A) and promoter activity (Fig 4B), proving that NF-jB is required for both stimulated pathways The efficacy of antisense oligonucleotides to reduce the expression of NF-jB is shown in Fig 4C Effects of NF-jB inhibition on PAI-1 expression The NF-jB complex is retained in the cytoplasm by IjB proteins Activation of NF-jB involves its phosphorylation by IjB kinase (IKK) and subsequent degradation of IjB by 26S proteasome To inhibit NF-jB, we treated endothelial cells with a relatively specific IjBa 26S proteasome inhibitor, MG132 used in the concentration range 0–1000 nm to prevent degradation of IjBa In the presence of MG132, TNFa-induced expression of PAI-1 detected at the level of mRNA (Fig 5C) or protein synthesis (Fig 5A) was blocked in a concentration-dependent manner Similarly, the stimulating effect of TNFa was abolished by salicylate, which is an IKK inhibitor (Fig 5B,D) The data are consistent with observations presenting the effect of TNFa on PAI-1 promoter activity (Fig 5E) and mRNA expression (Fig 5F) tested in endothelial cells transfected either with empty vector (pCMV4), or containing wild-type IjBa (WT) or mutated IjBa (MT) Transfection with pCMV4 or WT-IjBa had little or no effect on TNFa-induced PAI-1 mRNA expression or promoter activity However, overexpression of MT-IjBa, which cannot be phosphorylated at Ser32 and Ser36, resulted in a substantial decrease in TNFa-induced PAI-1 expression and promoter activity These findings indicate that signaling pathways proximal to IjBa phosphorylation (i.e IKK) are potential targets for activation by ROS FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS 5823 The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al A C Fig (A, B) The effect of TNFa (50 ngỈmL)1) on intracellular oxidation analyzed by DCF fluorescence in vascular endothelial cells with and without of NAC (10 mM) (C) The effect of PEG and PEGcatalase on endothelial cells stimulated with TNFa Results were obtained after h of TNFa stimulation in the presence of PEG alone or PEG-catalase (100–1000 mL)1) Experiments were performed three times with similar results Discussion In this study, we have shown that TNFa-induced expression and gene transcription of PAI-1 involve a regulatory region present in segment )664 ⁄ )680 of the PAI-1 promoter, corresponding to the previously reported IL-1a-inducible site located between )675 and )669 [24] This is supported by the following observations: (a) the oligonucleotide containing the putative jB-binding site of PAI-1 promoter ()664 ⁄ )680) can 5824 bind transcriptional factor subunits p50 and p65 This binding is specific and can be abolished by triple mutation of the oligonucleotide, as seen both in the direct binding and during competitive inhibition experiments (b) Mutation of the regulatory region abolished its responsiveness in the PAI-1 promoter to both TNFa and ROS, as demonstrated after the transfection of cells with p800Luc or its mutated version, respectively Furthermore, responsiveness of this element to activation of endothelial cells by TNFa or ROS was also FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al B A TNFα H2O2 [µΜ] NAC 100 200 100 200 100 200 100 200 C TNFα H2O2 NAC 4G/5G Consensus Mutant A-p65 D 45 Induction (%) NF-κB-SEAP activity (% of control) 140 120 30 15 E 100 80 60 40 20 TNFα NAC p-800Luc p-800Luc-(664-680) TNFα Fig Increased expression of NF-jB in endothelial cells with upregulated PAI-1 upon treatment with TNFa EMSAs using oligonucleotides derived from consensus sequence of NF-jB (A) and containing the putative of jB binding site of PAI-1 promoter (B) Endothelial cells were stimulated with TNFa (50 ngỈmL)1) or H2O2 (100 and 200 lM) in the presence of NAC (10 mM) (C) EMSAs using oligonucleotides (ACGTGGGGGAGTCAGCC) containing putative of jB binding site of PAI-1 promoter Endothelial cells were stimulated with TNFa (50 ngỈmL)1) or H2O2 (200 lM) in the presence or absence of NAC (10 mM) In the competition experiment, an excess amount unlabeled oligonucleotide containing the putative NF-jB binding site of PAI-1 promoter or unlabeled mutanted oligonucleotide or unlabeled consensus of NF-jB oligonucleotide was added to binding system 10 prior to adding labeled oligonucleotide The nuclear complex produced with the NF-jB probe is supershifted by the p65 antibody Endothelial cells were transfected with pNF-jB-SEAP in the presence of the pSEAP as a control vector The cells were preincubated with antioxidant NAC (10 mM) for 30 and then treated with TNFa (50 ngỈmL)1) Secreted alkaline phosphatase (SEAP) activities in the cells were determined by Chemiluminescence Detection Kit (D) (E) A mutation of the NF-jB putative binding site ()664 to )680) within PAI-1 promoter abolishes its sensitivity to TNFa-induced transcriptional activity In this experiment endothelial cells were transfected either with p800Luc or its mutated version, in which the )664 to )680 fragment (ACGTGGGGGAGT CAGCC) was substituted by the mutated sequence (ACATGGGCCAGTCAGCC) Mutation of the wild-type sequence was done on a PAI-1 promoter cloned into pLuc vector Transfected cells were treated with TNFa (50 ngỈmL)1) for 24 h and the cells harvested 12 h later Luciferase activity was determined by the Dual-Luciferase assay kit Data are shown as the mean of three separate experiments ± SD demonstrated by EMSA experiments Interestingly, this regulatory element is adjacent to the polymorphic locus, )675 4G ⁄ 5G insertion ⁄ deletion, which has stimulated increased interest in PAI-1 as a risk factor for venous thrombosis [25] In particular, the 4G allele in this polymorphism has been associated with higher FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS 5825 The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al A B C Fig Effect of oligonucleotides antisense to RelA p65 on PAI-1 mRNA expression and promoter activity in endothelial cells Endothelial cells were preincubated with the sense or antisense oligonucleotides and then treated with TNFa (50 ngỈmL)1) or H2O2 (100 lM) (A) Expression of PAI-1 mRNA determined by real-time PCR and (B) activity of PAI-1 promoter (C) Treatment of endothelial cells with the oligonucleotide antisense to RelA p65 abolished formation of the nuclear complex with the labeled probe containing NF-jB consensus sequence, as determined by EMSA 5826 levels of plasma PAI-1 antigen and PAI-1 activity [26] Furthermore, in the presence of the 4G allele not only was the PAI-1 response more pronounced, but so too was the response of other acute-phase reactants, which implies that the increases in these reactants are secondary to the increase in PAI-1 [27] Our data show that activation of endothelial cells with TNFa to produce PAI-1 is mediated by a ROSstimulated increase in NF-jB activity Treatment with H2O2 increased PAI-1 expression and the effect was reduced by cotreatment with the antioxidant, NAC Indeed, direct inhibition of NF-jB, either by antisense oligonucleotide or by overexpression of IjBa, attenuated both TNFa- and H2O2-induced PAI-1 expression TNFa was reported to induce both superoxide anion and H2O2 production [28,29] Because TNFa and ROS have similar effects on PAI-1 expression, these findings suggest a common mechanism by which these signaling pathways lead to the induction of PAI-1 in endothelial cells Interestingly, PAI-1 upregulation by TGF-b has also been shown to involve ROS production in mesangial cells [30] Furthermore, high glucose [31] and cyclic strain [32] can upregulate PAI-1 expression in endothelial cells through ROS generation Indeed, PAI-1 is regulated by a redox-sensitive mechanism after the exposure to ionizing radiation in renal tubular epithelial cells [33] In addition, IL-1-mediated upregulation of PAI-1 expression in cardiac microvascular endothelial cells also appears to be ROS dependent [34] In this study, we also characterized the inhibitory mechanism produced by antioxidants on TNFainduced PAI-1 expression in endothelial cells Our findings indicate that this inhibition occurs via the suppression of NF-jB Although TNFa could activate NF-jB by a ROS-independent mechanism, the ability of ROS to stimulate NF-jB activity may provide a synergistic effect in this activation [35] TNFa is known to mediate the PAI-1 acute phase response in vivo and a jB-like sequence has been found in a number of promoters of acute phase-regulated genes [36] Involvement of the NF-jB signaling pathway in PAI-1 upregulation has been reported in human endothelial cells stimulated by lipopolysaccharide [37] and in proximal tubular cells exposed to uremic toxins [38] NF-jB also contributes to Chlamydia pneumoniae-induced overexpression of PAI-1 in vascular smooth muscle cells and endothelial cells [39] Furthermore, NF-jB-like binding site in the PAI-1 promoter is responsible for IL-1-induced PAI-1 expression and this element is involved in the control of plasma levels of PAI-1 [24] Thus, multiple cytokines and infectious agents can upregulate PAI-1 FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al B A C Fig Dependence of PAI-1 expression upon NF-jB activation (A, B) Inhibition of PAI-1 antigen expression produced by incubation of TNFa-stimulated endothelial cells with increasing concentrations of 26S proteasome inhibitor, MG132 and sodium salicylate, respectively (C, D) Similar reduction in PAI-1 mRNA expression in the same cells as analyzed by real-time PCR All experiments were performed at least times with reproducible results and data are shown as mean ± SD (E, F) Changes in PAI-1 expression as measured at the level of PAI-1 promoter activity and PAI-1 mRNA evaluated by real-time PCR, respectively In these experiments, endothelial cells were transfected with the empty vector (pCMV4), and the vector expressing either a wild-type IjBa (WT) or its nonphosphorylable mutant IjBa (MT) Results were standardized to cotransfection RSV-b-Gal expression plasmid (internal control) All data represent the mean of three separate experiments ± SD D E expression, leading to altered vascular hemostasis and proliferation Experimental procedures Reagents All standard tissue culture reagents including M199 and fetal bovine serum were obtained from Gibco-BRL (Bethesda, MD, USA) TNFa were obtained from Promega (Madison, WI, USA) All other reagents were obtained from Sigma (St Louis, MO, USA), unless indicated otherwise The inhibitor Z-Leu-Leu-Leu-CHO (MG132) was from BioMol (Plymouth Meeting, PA, USA) The chemiluminescence detection reagent for western blotting was from Pierce (Rockford, IL, USA) The protein determination assay reagent, acrylamide, TEMED, and ammonium persulfate were from Bio-Rad (Hercules, CA, USA) LipofectAMINE Plus reagent was obtained from Gibco-BRL Plasmid p800LUC with PAI-1 promoter was obtained as a F gift from D J Loskutoff (Scripps Institute, La Jolla, CA, USA) Plasmids with wild-type IjBa (WT) and mutated IjBa (MT) were obtained as a gift from J K Liao (Harvard Medical School, Boston, MA, USA) [32P]dATP[cP] (6000 CiỈmmol)1) and T7 Sequenase (v.2.0) were purchased from Amersham (Piscataway, NJ) Protein assay reagents and polyacrylamide gel chemicals were from Bio-Rad P-NF-jB-SEAP vector and SEAP Chemiluminescence Detection Kit was from BD Bioscience Clontech (Mountain View, CA, USA) Cell culture Human umbilical vein endothelial cells (HUVEC) were cultured in growth medium containing M199 and 20% (v ⁄ v) fetal bovine serum in a 90–95% humidified atmosphere of 5% (v ⁄ v) CO2 at 37 °C To evaluate the effect of different compounds on PAI-1 expression at the level of protein synthesis, cells were grown on 48-well microplates To determine PAI-1 mRNA levels, endothelial cells were cultured in FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS 5827 The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al 10 cm dishes In all experiments, cellular viability was assessed by Trypan Blue dye-excluding cells Relatively pure (> 95%) vascular endothelial cells were confirmed by their morphological features using phase-contact microscopy and immunofluorescent staining with PECAM-1 antibody (data not shown) At the concentrations used, there were no observable adverse effects of TNFa, superoxide dismutase, catalase or other antioxidants on cellular viability for all treatment conditions Treatment conditions Prior to treatment with TNFa, endothelial cells were starved for  12 h in M199 supplemented with 0.1% (v ⁄ v) fetal bovine serum Endothelial cells were then stimulated with TNFa (50 ngỈmL)1) or H2O2 (100 and 200 lm) in the presence and absence of NAC (10 mm), pyrrolidinedithiocarbamate (100 lm), vitamin C (100 lm) and catalase (500 mL)1) In some experiments, the 26S proteasome inhibitor, MG132 (10 nm to lm), was added 30 prior to TNFa stimulation Sodium salicylate (2 and mm) was added h before the TNFa stimulation Real-time quantitative RT-PCR Total RNA (1 lg) was extracted from endothelial cells using Trizol reagent (Life Technologies Inc, Rockville, MD, USA) and processed directly to cDNA synthesis using the TaqMan Reverse Transcription Reagents kit (Applied Biosystems, Foster City, CA, USA), according to the manufacturer’s protocol The PAI-1 and b-actin expression was quantified by real-time RT-PCR using ABI Prism 7000 Sequence Detection System (Applied Biosystems), according to the manufacturer’s protocol Briefly, 2.5, 2.0; 1.5, 1.0; 0.5 and 0.25 lL of synthesized cDNA were amplified in triplicate for both b-actin and each of the target genes to create a standard curve Likewise, lL of cDNA was amplified in triplicate in all isolated samples for each primer ⁄ probe combination and b-actin Each sample was supplemented with both respective 0.3 lm forward and reverse primers, fluorescent probe, and made up to 50 lL using qPCRTM Mastermix for SYBR Green I (Eurogentec, Seraing, Belgium) All the following PCR primers were designed using software primerexpress (Applied Biosystems) forward 5¢-TGCTGGTGAATGCCCTCTACT-3¢, reverse 5¢-CGGTCATTCCCAGGTTCTCTA-3¢ forward 5¢-CGTA CCACTGGCATCGTGAT-3¢, reverse 5¢-GTGTTGGCGT ACAGGTCTTTG-3¢ specific for mRNAs of PAI-1 and b-actin, respectively b-Actin was used as an active and endogenous reference to correct for differences in the amount of total RNA added to the reaction and to compensate for different levels of inhibition during reverse transcription of RNA and during PCR Each target probe was amplified in a separate 96-well plate All samples were incubated at 50 °C for and at 95 °C for 10 min, and then 5828 cycled at 95 °C for 30 s, 56 °C for and 72 °C for for 40 cycles SYBR Green I fluorescence emission data were captured and mRNA levels were quantified using the critical threshold (Ct) value Analyses were performed with abi prism 7000 (SDS Software) Controls without reverse transcription and with no template cDNA were performed with each assay To compensate for variations in input RNA amounts, and efficiency of reverse transcription, b-actin mRNA was quantified and results were normalized to these values Relative gene expression levels were obtained using the DCt method Amplification specific transcripts were further confirmed by obtaining melting curve profiles Assay of intracellular oxidative stress HUVEC of fewer than three passages were cultured in 35 mm dishes (Corning, NY, USA) coated with 0.1% (w ⁄ v) gelatin Phenol-free M199 medium + 15 mm Hepes (pH 7.4) were used Before seeding the endothelial cells, a sterile cover-slip was placed on the bottom of each dish To subtract background fluorescent activity from intracellular fluorescence, these cover-slips were eliminated before measurement in order to have a cell-free control field The preincubation period with antioxidants was 30 Intracellular generation of ROS was quantified using 2¢7¢dichlorofluorescein diacetate (DCFH-DA) (Molecular Probes, Eugene, OR, USA) This esterified form is cell membrane permeable and undergoes deacetylation by intracellular esterases Upon oxidation, DCFH is converted to dichlorofluorescin (DCF), a fluorescent compound Confluent endothelial cell monolayers were incubated 30 with 30 lm DCFH-DA before stimulation with TNFa Briefly, PEG and PEG-catalase were dissolved in phenol-free culture medium and applied to endothelial cells h before stimulation with TNFa Results were obtained after h of TNFa stimulation in the presence of PEG alone or PEG-catalase (100–1000 mL)1) Fluorescence was monitored using an inverted microscope (Zeiss Axiovert 405M, Oberkochen, Germany) with a specimen stage for 35 mm dishes This custom-design stage was equipped with a temperature and gas control, thus allowing incubator conditions [i.e 5% (v ⁄ v) CO2, 37 °C] under the microscope Culture medium pH was 7.4 under microscopy conditions A mercury lamp with a 490 nm filter was used as a light source for excitation Excitation time (3 s) was constant for all conditions The emission wavelength was set to 525 nm Images were acquired using a CCD camera (Photometrics CH 250, Tucson, CA, USA) with a 512 · 512 pixel format Digitalized images were transferred to a Sun SPARC workstation IPX (Sun Microsystems, Mountain View, CA, USA) Analysis was performed with isee software v 3.6 (Inovision, Durham, NC, USA) For each condition, data were acquired from six different and representative fields (three separate FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al regions of interest within two separate microscopic fields) Fluorescence intensity (excitation wavelength 490 nm; emission wave length 520 nm; excitation time s) was recorded on a gray scale from to 16 384 Background fluorescence (cell-free area) was subtracted from total fluorescent intensity EMSA Confluent HUVECs were stimulated with TNFa (50 ngỈmL)1) for h The double-stranded oligonucleotides: (a) transcription factor consensus oligonucleotide for NF-jB (AGTTGAGGGCACTTTCCCAGG) obtained from Integrated DNA Technologies, Inc (Coralville, IA, USA), (b) PCR products containing wild-type sequence from )664 to )680 of PAI-1 promoter (ACGTGGGGG AGTCAGCC), and (c) an oligonucleotide from the sequence )664 to )680 of PAI-1 promoter (ACGTGGGG GAGTCAGCC) were used as labeled probe The introduction the mutations to wild-type sequence from )664 to )680 of PAI-1 promoter cloned into pLUC vector was carried out using a Quick Change site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) with mutagenic primers: 5¢-ACATGGGGGAGTCAGCC-3, 5¢-GGCTGACTCC CCCATGT-3¢; 5¢-ACATGGGGCAGTCAGCC-3, 5¢-GG CTGACTGCCCCATGT-3¢; 5¢-ACATGGGCCAGTCAG CC-3, 5¢-GGCTGACTGGCCCATGT-3¢ The PCR product and the oligonucleotides were labeled to high specific activity with T4 polynucleotide kinase (Promega) using [32P]dATP[cP] (Amersham Biotech) 37 °C for 10 and subsequently purified by electrophoresis in 7% polyacrylamide gels using 0.5· Tris ⁄ borate ⁄ EDTA, pH 7.8 We used 6–7 · 104 c.p.m for EMSA Binding reactions were performed in the binding buffer 20 mm Hepes ⁄ KOH, pH 7.5, 32 mm KCL, mm MgCl2, mm dithiothreitol, 10% (v ⁄ v) glycerol) in the presence of nonspecific competitor poly(dI:dC) (Amersham Biotech) Crude nuclear extracts (15 lg) from control cells and stimulated with TNFa (50 ngỈmL)1) cells were incubated with 0.01 pmol of c32P-labeled oligonucleotides and PCR products for 20 at room temperature in a total volume of 20 lL For competition experiments, 200-fold molar excess of unlabeled double-stranded competitor oligonucleotides (consensus of NF-jB, the sequence from )664 to )680 of PAI-1 promoter, mutated fragment )664 to )680 of PAI-1 promoter) were added to the reaction mixtures To identify a transcription factor, lg of polyclonal antibodies against NF-jB subunits (p50, p65) were introduced to the binding reactions for 30 prior to the addition of the radioactive probe DNA–protein complexes were resolved from unbound oligonucleotides and PCR products by elecrophoresis on 5% polyacrylamide gel using 0.5· Tris ⁄ borate ⁄ EDTA buffer (150 V for h) Gels were vacuumdried and autoradiographed with intensifying screens for 2–24 h at )20 °C Antisense oligonucleotide transfection To transfect antisense oligonucleotides to RelA, cells were cultured in six-well plates and grown in M199 containing 20% (v ⁄ v) fetal bovine serum After 24 h, wells were washed with serum- and antibiotic-free medium Phosphorothioate oligonucleotides (200 nm) and the oligofectamine reagent (Invitrogen, Life Technologies) were added to the wells Cells were incubated for 20 h with sense (5¢-GC CATGGACGAACTGTTCCCC-3¢) or antisense (5¢-GGG GAACAGTTCGTCCATGGC-3¢) oligonucleotides and then treated for additional h with TNFa or H2O2 and total cellular RNA was isolated by the TRIzol Reagent Plasmids construcions Introduction of mutations to the wild-type sequence from )664 to )680 of PAI-1 promoter cloned into pLUC vector was carried out using a Quick Change site-directed mutagenesis kit (Stratagene) and mutagenic primers: 5¢-AC ATGGGGGAGTCAGCC-3¢, 5¢-GGCTGACTCCCCCAT GT-3¢; 5¢-ACATGGGGCAGTCAGCC-3¢, 5¢-GGCTGA CTGCCCCATGT-3¢; 5¢-ACATGGGCCAGTCAGCC-3¢, 5¢-GGCTGACTGGCCCATGT-3¢ The nickled vector DNA incorporating the desired mutations was than transformed into XL1-Blue cells Transfection reporter assays Semiconfluent cell cultures in six-well tissue culture plates were transfected with DNA constructs (plasmid p800LUC with the PAI-1 promoter, p800LUCmut containing mutated sequence from )664 to )680 of the PAI-1 promoter and pCMV.IjBa expression vector) or with pNF-jB-SEAP vector The cells were grown in six wells with a density of  · 105 cellsỈmL)1 and transfected using lg of the plasmid DNA and lipoficatmine (Gibco BRL) according to manufacturer’s instructions As an internal control for transfection efficiency, pRSV.bGAL plasmid (0.5 lg) was cotransfected in all experiments In parallel experiments, endothelial cells were transfected with luciferase reporter vector pGL3 (Promega) and used as control cells to test whether the effect of inhibitors was specific for the PAI-1 promoter Overexpression of IjBa The following expression plasmids were used: (a) WT IjBa, encoding the full-length protein, was N-terminus FLAGtagged in pCMV4 (b) MT IjBa, lacking the serine phosphorylation sites (32 and 36) and thus resistant to degradation by the 26S proteasome, was also N-terminus FLAG-tagged in pCMV4 Endothelial cells were transfected with IjBa expression plasmids by lipofectamine method FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS 5829 The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al After 48 h cells were treated with TNFa (50 ngỈmL)1) and total cellular RNA isolated h later by using the TRIzol Reagent Statistical analysis All values are expressed as mean ± SE compared with controls and among separate experiments Paired and unpaired Student’s t-tests were employed to determine the significance of changes A P-value < 0.05 was considered statistically significant Acknowledgements This work was supported by the Polish Committee for Scientific Research (KBN) Grant no PO4A 01425 References Horrevoet AJ (2004) Plasminogen activator inhibitor (PAI-1): in vitro activities and clinical relevance Br J Haematol 125, 12–23 Sato Y, Tsuboi R, Lyons R, Moses H & Rifkin DB (1990) Characterization of the activation of latent TGFbeta by co-cultures of endothelial cells and pericytes or smooth muscle cells: a self-regulating system J Cell Biol 111, 757–763 Lau HK (1999) Regulation of proteolytic enzymes and inhibitors in two smooth muscle cell phenotypes Cardiovasc Res 43, 1049–1059 Cockell KA, Ren S, Sun J, Angel A & Shen GX (1995) Effect of thrombin on the release of plasminogen activator inhibitor-1 from cultured primate arterial smooth muscle cells Thromb Res 77, 119–131 Samad F, Yamamoto K & Loskutoff DJ (1996) Distribution and regulation of plasminogen activator inhibitor-1 in murine adipose tissue in vivo Induction by tumor necrosis factor-alpha and lipopolysaccharide J Clin Invest 97, 37–46 Nordt T, Schneider D & Sobel B (1994) Augmentation of the synthesis of plasminogen activator inhibitor type-1 by precursors of insulin A potential risk factor for vascular disease Circulation 89, 321–330 Brown NJ, Kim KS, Chen YQ, Blevins LS, Nadeau JH, Meranze SG & Vaughan DE (2000) Synergistic effect of adrenal steroids and angiotensin II on plasminogen activator inhibitor-1 production J Clin Endocrinol Metab 85, 336–344 Dichtl W, Stiko A, Eriksson P, Goncalves I, Calara F, Banfi C, Ares MP, Hamsten A & Nilsson J (1999) Oxidized LDL and lysophosphatidylcholine stimulate plasminogen activator inhibitor-1 expression in vascular smooth muscle cells Arterioscler Thromb Vasc Biol 19, 3025–3032 5830 Mottonen J, Strand A, Symersky J, Sweet RM, Danley DE, Geogheggan KF, Gerard RD & Goldsmith EJ, (1992) Structural basis of latency in plasminogen activator inhibitor-1 Nature 355, 270–273 10 Lawrence DA, Olson ST, Palaniappani S & Ginsburg D (1994) Serpin reactive center loop mobility is required for inhibitor function but not for enzyme recognition Biochemistry 33, 3643–3648 11 Chen YQ, Su M, Walia RR, Hao Q, Covington JW & Vaughan DE (1998) Sp1 sites mediate activation of the plasminogen activator inhibitor-1 promoter by glucose in vascular smooth muscle cells J Biol Chem 273, 8225– 8231 12 Fink T, Kazlauskas A, Poellinger L, Ebbesen P & Zachar V (2002) Identification of a tightly regulated hypoxia-response element in the promoter of human plasminogen activator inhibitor-1 Blood 99, 2077–2083 13 Eriksson P, Nilsson L, Karpe F & Hamsten A (1998) Very-low-density lipoprotein response element in the promoter region of the human plasminogen activator inhibitor-1 gene implicated in the impaired fibrinolysis of hypertriglyceridemia Arterioscler Thromb Vasc Biol 18, 20–26 14 Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S & Gauthier JM (1998) Direct binding of Smad3 and Smad4 to critical TGF beta-inducible elements in the promoter of human plasminogen activator inhibitortype gene EMBO J 17, 3091–3310 15 Vulin AI & Stanley FM (2004) Oxidative stress activates the plasminogen activator inhibitor type (PAI-1) promoter through an AP-1 response element and cooperates with insulin for additive effects on PAI-1 transcription J Biol Chem 279, 25172–25178 16 Al-Nedawi KN, Czyz M, Bednarek R, Szemraj J, Swiatkowska M, Cierniewska-Cieslak A, Wyczolkowska J & Cierniewski CS (2004) Thymosin beta induces the synthesis of plasminogen activator inhibitor in cultured endothelial cells and increases its extracellular expression Blood 103, 1319–1324 17 Hou B, Eren M, Painter CA, Covington JW, Dixon JD, Schoenhard JA & Vaughan DE (2004) Tumor necrosis factor alpha activates the human plasminogen activator inhibitor-1 gene through a distal nuclear factor kappaB site J Biol Chem 279, 18127–18136 18 Ranta V, Orpana A, Carpen O, Turpeinen U, Ylikorkala O & Viinikka L (1999) Human vascular endothelial cells produce tumor necrosis factor-alpha in response to proinflammatory cytokine stimulation Crit Care Med 27, 2184–2187 19 Imaizumi T, Itaya H, Fujita K et al (2000) Expression of tumor necrosis factor-alpha in cultured human endothelial cells stimulated with lipopolysaccharide or interleukin-1alpha Arterioscler Thromb Vasc Biol 20, 410–415 FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS The 4G ⁄ 5G site and PAI-1 expression M Swiatkowska et al 20 Keulenaer GW, Alexander WR, Ushio-Fukai M, Ishizaka N & Griendling KK (1998) Tumour necrosis factor a activates a p22phox-based NADH oxidase in vascular smooth muscle Biochem J 329, 653–657 21 Kunsch Ch & Medford RM (1999) Oxidative stress as a regulator of gene expression in the vasculature Circ Res 85, 753–766 22 Sundaresan MYuZX, Ferrans VJ, Irani K & Finkel T (1995) Requirement for generation of H2O2 for plateletderived growth factor signal transduction Science 270, 298–301 23 Sen CK & Packer L (1996) Antioxidant and redox regulation of gene transcription FASEB J 10, 709–720 24 Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S & Henney A (1993) The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells J Biol Chem 268, 10739–10745 25 Lane DA & Grant PJ (2000) Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease Blood 95, 1517–1532 26 Grancha S, Estelles A, Tormo G, Falco C, Gilabert J, Espana F, Cano A, Segui R & Aznar J (1999) Plasminogen activator inhibitor-1 (PAI-1) promoter 4G ⁄ 5G genotype and increased PAI-1 circulating levels in postmenopausal women with coronary artery disease Thromb Haemostat 81, 516–521 27 Hoekstra T, Geleijnse JM, Schouten EG & Kluft C (2004) Plasminogen activator inhibitor-type 1: its plasma determinants and relation with cardiovascular risk Thromb Haemostat 91, 861–872 28 Murphy HS, Shayman JA, Till GO, Mahrougui M, Owens CB, Ryan US & Ward PA (1992) Superoxide responses of endothelial cells to C5a and TNF-a: divergent signal transduction pathways Am J Physiol Lung Cell Mol Physiol 263, L51–L59 29 Matsubara T & Ziff M (1986) Increased superoxide anion release from human endothelial cells in response to cytokines J Immunol 137, 3295–3329 30 Jiang Z, Seo JY, Ha H, Lee EA, Kim YS, Han SCh, Uh ST, Park Ch S & Lee HB (2003) Reactive oxygen species mediate TGF-b1-induced plasminogen activator inhibitor-1 upregulation in mesantial cells Biochem Bioph Res Commun 309, 961–966 31 Du XL, Edelstein D, Rossetti L, Fantus IG, Goldberg H, Ziyadeh FN, Wu J & Brownlee M (2000) Hyperglycemiainduced mitochondrial superoxide overproduction activates the hexoamine pathway and induces plasminogen activator inhibitor-1 expression by increasing Sp1 glycosylation Proc Natl Acad Sci USA 97, 12222–12226 32 Cheng JJ, Chao YJ, Wung BS & Wang DL (1996) Cyclic-strain-induced plasminogen activator inhibitor-1 (PAI-1) release from endothelial cells involves reactive oxygen species Biochem Biophys Res Commun 225, 100–105 33 Zhao W, Spitz DR, Oberley LW & Robbins MEC (2001) Redox modulation of the pro-fibrogenic mediator plasminogen activator inhibitor-1 following ionizing radiation Cancer Res 61, 5537–5543 34 Okada H, Woodcock-Mitchell J, Mitchell J, Sakamoto T, Marutsuka K, Sobel BE & Fujii S (1998) Induction of plasminogen activator inhibitor type and collagen expression in rat cardiac microvascular endothelial cells by interleukin-1 and its dependence on oxygen-centered free radicals Circulation 97, 2175–2182 35 Janssen-Heininger YM, Macara I & Mossman BT (1999) Cooperativity between oxidants and tumor necrosis factor in the activation of nuclear factor NF-jB: requirement of Ras ⁄ mitogen-activated protein kinases in the activation of NF-jB by oxidants Am J Respir Cell Mol Biol 20, 942–952 36 Baeuerle PA & Henkel T (1996) Function and activation of NF-jB in the immune system Annu Rev Immunol 12, 141–117 37 Ruan QR, Zhang WJ & Hunfnagl P (2001) Anisodamine counteracts lipopolysaccharide-induced tissue factor and plasminogen activator inhibitor-1 expression in human endothelial cells: contribution of the NF-jB pathway J Vasc Res 38, 13–19 38 Motojima M, Hosokawa A, Yamato H, Muraki T & Yoshioka T (2003) Uremic toxin of organic anions upregulate PAI-1 expression by induction of NF-jB and free radical in proximal tubular cells Kidney Int 63, 1671–1680 39 Dechend R, Maass M, Gieffers J, Dietz R, Scheidereit C, Leutz A & Gulba DC (1999) Chlamydia pneumoniae infection of vascular smooth muscle and endothelial cells activates NF-jB and induces tissue factor and PAI-1 expression Circulation 100, 1369–1373 FEBS Journal 272 (2005) 5821–5831 ª 2005 The Authors Journal Compilation ª 2005 FEBS 5831 ... endothelial cells Expression of PAI-1 was analyzed at the level of protein synthesis (A) in the presence or absence of NAC (10 mM) The PAI-1 antigen was determined using the ELISA test (B) PAI-1. .. Upregulation of PAI-1 expression in endothelial cells by ROS In preliminary experiments, we evaluated the role of ROS during the stimulation of PAI-1 expression in endothelial cells by TNFa For this... was the response of other acute-phase reactants, which implies that the increases in these reactants are secondary to the increase in PAI-1 [27] Our data show that activation of endothelial cells