Báo cáo khoa học: Induction of PPARb and prostacyclin (PGI2) synthesis by Raf signaling: failure of PGI2 to activate PPARb potx

Induction of PPARb and prostacyclin (PGI 2 ) synthesis by Raf signaling: failure of PGI 2 to activate PPARb Tanja Fauti 1 , Sabine Mu ¨ ller-Bru ¨ sselbach 1 , Mihaela Kreutzer 1 , Markus Rieck 1 , Wolfgang Meissner 1 , Ulf Rapp 2 , Horst Schweer 3 , Martin Ko ¨ mhoff 3 and Rolf Mu ¨ ller 1 1 Institute of Molecular Biology and Tumor Research (IMT), Philipps-University, Marburg, Germany 2 MSZ, University of Wu ¨ rzburg, Germany 3 Department of Pediatrics, Philipps-University, Marburg, Germany All prostaglandins [PGD 2 , PGE 2 , PGF 2 , PGI 2 (prosta- cyclin), 15-deoxy-D 12,14 -PGJ 2 ] and thromboxane A 2 are synthesized from the common precursor PGH 2 , which is generated by cyclooxygenase (Cox)-1 and Cox-2 from arachidonic acid (AA) (see [1] and references therein). Cyclooxygenase-2 is regulated by transcrip- tional and post-translational mechanisms in response to a plethora of stimuli, while Cox-1 expression is con- stitutive. Prostaglandin D 2 , PGE 2 , PGF 2 and PGI 2 can trigger signaling cascades by interacting with G-protein coupled membrane receptors. Prostaglandin I 2 has also been proposed as an agonist of the ‘peroxisome prolif- erator activated receptor-b’ (PPARb; also known as PPARoad) [2–5]. Prostanoids play essential roles in many physiological processes, such as inflammation, pain, fever and platelet aggregation, but some compo- nents of the prostanoid signaling network also figure in tumorigenesis, including PGE 2 and the PPARs. While the former plays a predominant role in promoting tumor angiogenesis through upregulation of proangio- genic growth factors [6,7], PGI 2 and PPARb have been suggested to play a role in cell proliferation, differenti- ation and apoptosis [5,8–11]. A role for PPARb in tumorigenesis has been pro- posed for human colon cancer cells where the APC tumor suppressor gene product inhibits PPARb Correspondence R. Mu ¨ ller, Institute of Molecular Biology and Tumor Research (IMT), Philipps-University, Emil-Mannkopff-Strasse 2, 35033 Marburg, Germany E-mail: rmueller@imt.uni-marburg.de (Received 25 August 2005, revised 24 Octo- ber 2005, accepted 8 November 2005) doi:10.1111/j.1742-4658.2005.05055.x A role for the nuclear receptor peroxisome proliferator-activated recep- tor-b (PPARb) in oncogenesis has been suggested by a number of obser- vations but its precise role remains elusive. Prostaglandin I 2 (PGI 2 , prostacyclin), a major arachidonic acid (AA) derived cyclooxygenase (Cox) product, has been proposed as a PPARb agonist. Here, we show that the 4-hydroxytamoxifen (4-OHT) mediated activation of a C-Raf-estrogen receptor fusion protein leads to the induction of both the PPARb and Cox-2 genes, concomitant with a dramatic increase in PGI 2 synthesis. Sur- prisingly, however, 4-OHT failed to activate PPARb transcriptional activ- ity, indicating that PGI 2 is insufficient for PPARb activation. In agreement with this conclusion, the overexpression of ectopic Cox-2 and PGI 2 syn- thase (PGIS) resulted in massive PGI 2 synthesis but did not activate the transcriptional activity of PPARb. Conversely, inhibition of PGIS blocked PGI 2 synthesis but did not affect the AA mediated activation of PPARb. Our data obtained with four different cell types and different experimental strategies do not support the prevailing opinion that PGI 2 plays a signifi- cant role in the regulation of PPARb. Abbreviations AA, arachidonic acid; ASA, acetylsalicylic acid; Cox, cyclooxygenase (EC 1.44.99.1); cPGI, carbaprostacyclin; cPLA 2 , cytosolic phospholipase A 2 (EC 3.1.1.5); DBD, DNA-binding domain; EPA, eicosapentaenoic acid; ERK, extracellular signal-regulated kinase; 6-k-PGF 1a , 6-keto- prostaglandin F 1a ; LBD, ligand-binding domain; mPGES, microsomal prostaglandin E 2 synthase (EC 5.3.99.3); 4-OHT, 4-hydroxytamoxifen; PGE 2 , prostaglandin E 2 ; PGI 2 , prostaglandin I 2 (prostacyclin); PGIS, prostaglandin I 2 synthase (prostacyclin synthase; EC, 5.3.99.4); PPAR, peroxisome proliferator activated receptor; qPCR, quantitative PCR (real-time PCR). 170 FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS transcription by TCF-4 (Wnt pathway) [8,12]. In mouse models of intestinal tumorigenesis (such as the Apc Min mouse) PPARb has also been reported to affect tumor growth, albeit with partly contradictory conclusions: the homozygous deletion of PPARb resul- ted in the formation of smaller tumors [13] but led to enhanced tumor growth in a more recent study using a different PPARb null mouse [14]. Furthermore, the pharmacological activation of PPARb has been shown to accelerate the growth of intestinal adenomas [15]. In line with a pro-oncogenic function of the pro- posed PPARb agonist PGI 2 is the observation that in human colon carcinoma PGI 2 released by stromal fibroblasts promotes the survival of the tumor cells [5], and that apoptosis in mesenchymal renal medullary interstitial cells is reduced by overexpression of PPARb and further decreased upon administration of cPGI [16]. In apparent contrast to these observations is the finding that the ectopic expression of prostaglandin I 2 synthase (prostacyclin synthase; EC 5.3.99.4) inhibits mouse lung tumorigenesis [17] and promotes apoptosis [3]. The interpretation of these studies is, however, complicated because there is no definitive proof that natural PGI 2 is a PPARb agonist and other potential PPARb ligands may exist [18]. Moreover, other recent studies support the hypothesis that PPARb inhibits cell proliferation and promotes differentiation [11,19–22]. The Ras-Raf-ERK signaling pathway controls the activity of numerous transcription factors that are essential for the regulation of cell cycle progression and cell survival [23,24]. Different Ras-triggered path- ways have also been implicated in the regulation of genes involved in prostanoid synthesis and signaling, such as group IVA cytosolic, calcium-dependent phos- pholipase A 2 (cPLA 2 ), Cox-2 and PPARb, all of which have been implicated in tumorigenesis (see [1] for review). In the present study, we use a 4-hydroxy- tamoxifen (4-OHT) inducible system (N-BxB-ER cells) [25] to show that multiple components of the prosta- noid signaling network are targets of C-Raf signaling pathways. Triggering of C-Raf signaling resulted in a dramatic Cox-2 and ERK-dependent increase in the synthesis and release of PGE 2 and PGI 2 which was mainly due to a strong transcriptional activation of the Cox-2 gene (and to a lesser extent of PGIS and mPGES-1). Under the same experimental conditions expression of the PPARb gene was also augmented by C-Raf signaling suggesting the presence of an auto- crine or intracrine PGI 2 –PPARb signaling mechanism. Surprisingly, however, the observed massive induction of PGI 2 synthesis did not lead to the transcriptional activation of PPARb. In agreement with this finding, PPARb transcriptional activity was affected neither by the pharmacological inhibition of PGI 2 synthesis nor by the simultaneous overexpression of Cox-2 and PGIS. Our data therefore provide no evidence for an agonistic effect of PGI 2 on PPARb, indicating that physiological highly potent PPARb agonists, if exist- ent, remain to be identified. Results Induction of prostanoid synthesis by C-Raf signaling To investigate the effect of Raf signaling on prostanoid synthesis we made use of the 3T3-derived N-BxB-ER cells that express a 4-OHT inducible N-terminally truncated oncogenic Raf protein fused to the estrogen receptor [25]. Cells were treated with 4-OHT for differ- ent times in the absence and presence of AA and the concentrations of prostanoids was measured in the cell culture supernatants by GC-MS. Figure 1A shows a dramatic induction of both PGE 2 and the stable PGI 2 metabolite 6-k-PGF 1a . Induction of both prostanoids was detectable within 2 h of 4-OHT treatment and after 24 h reached values > 100-fold of the uninduced basal levels. In the presence of AA (Fig. 1A, bottom panel), synthesis of both prostanoids was greatly accel- erated and reached higher maximum levels, indicating that the level of endogenous AA generated by phos- pholipase A 2 is rate-limiting even in the presence of activated Raf. The induction of both prostanoids was almost completely blocked by the Cox-1 ⁄ 2 inhibitor acetylsalicylic acid (ASA) and the Cox-2 inhibitor SC-58125 (Fig. 1B), pointing to a key role for Cox-2 in the induction of prostanoid synthesis by Raf. In contrast to PGE 2 and 6-k-PGF 1a , no significant increase upon 4-OHT treatment was seen for throm- boxane B2 (TxB2), PGD 2 and PGF 2a (Fig. 1A). Effects of c-Raf signaling on genes encoding prostanoid-synthesizing enzymes We next analyzed by quantitative real-time PCR (qPCR) the effect of Raf activation on the expression of genes that are relevant for the synthesis of PGE 2 and PGI 2 . Figure 2A shows a strong induction of Cox-2 mRNA expression peaking at 240 min after 4-OHT addition, whereas no induction was seen for cPLA 2 . This finding was confirmed by northern blot- ting which showed a 10-fold induction of Cox-2 mRNA after 8 h (Fig. 2B and C). Induction was speci- fic for Cox-2, since no significant change in expression was seen with Cox-1 (Fig. 2B). These observations explain the effects of exogenous AA and the Cox-2 T. Fauti et al. Raf induction of PGI 2 synthesis in the absence of PPARb activation FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS 171 inhibitor on prostanoid synthesis in Fig. 1. We also observed a 4-OHT triggered increase in the levels of PGIS mRNA (Fig. 2A), but this was weak (1.3-fold) and is therefore unlikely to contribute significantly to the 4-OHT induced PGI 2 synthesis. Induction mPGES-1 occurred relatively late after 4-OHT treat- ment (4.7-fold 12 h post-treatment; Fig. 2B) suggestive of a secondary event. Taken together, these results indicate that Cox-2 is the key enzyme mediating the dramatic induction of PGE 2 and PGI 2 synthesis after Raf activation. The strong induction of Cox-2 expres- sion was virtually abolished by both the ERK inhibitor UO126 and the RNA polymerase inhibitor actinomy- cin D (Fig. 2C) indicating the Raf-triggered increase in Cox-2 mRNA expression is due to an ERK-mediated induction of Cox-2 transcription. Effects of C-Raf activation on PPARb expression Activation of Raf not only led to a dramatic induction of PGI 2 synthesis as described above, but in the same experimental setting also induced the expression of the PPAR b gene, which encodes the proposed nuclear receptor for PGI 2 . As illustrated in Fig. 3A, an approximately threefold increase in the level of PPARb mRNA was seen within 8 h of 4-OHT treatment. Induction was completely abolished by UO126 and actinomycin D (Fig. 3B), suggesting an absolute requirement for ERK function and unimpaired tran- scription as already seen with Cox-2 above. Effect of Raf activation on the transcriptional activity of PPARb The simultaneous upregulation of PGI 2 synthesis and PPARb expression suggested the induction of an auto- crine ⁄ intracrine signaling loop upon activation of Raf. We therefore investigated whether 4-OHT treatment of N-BxB-ER cells would lead to an activation of the transcriptional activity of PPARb. To address this question we constructed a luciferase reporter construct consisting of seven LexA binding sites upstream of a TATA-Initiator (TATA-Inr) module without any addi- tional promoter elements. This reporter plasmid on its own shows negligible luciferase activity and therefore allows for a highly sensitive detection of the transcrip- tional activity of a cotransfected transcriptional activa- tor harboring a LexA DNA binding domain (DBD). A B Fig. 1. Raf induces PGE 2 and PGI 2 synthesis. (A) Prostanoid levels in the culture medium of RafER3T3 cells after treatment with 4-OHT for the indicated times in the absence ()AA; upper panel) or presence of 20 l M arachidonic acid (+AA; bottom panel). 6-kPGF 1a is a stable metabolite of the unstable PGI 2 that is used as a direct measure of PGI 2 synthesis. (B) PGE 2 and 6-kPGF 1a levels in the culture medium of RafER3T3 cells after treatment with 4-OHT in the presence of 100 l M ASA or 0.1 lM SC-58125. All data points represent the average of two measurements. Raf induction of PGI 2 synthesis in the absence of PPARb activation T. Fauti et al. 172 FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS In this system, the synthetic PPARb agonist GW501516 gave a 30-fold induction with a fusion protein consisting of the PPARb ligand binding domain LBD and the LexA DBD (Fig. 4). In contrast, no induction was seen after treatment with 4-OHT in spite of the massive synthesis of the presumptive PPARb agonist PGI 2 . We also analyzed the effect of 4-OHT on a PPRE- HSV-tk-pomoter-driven luciferase reporter construct [26] in N-BxB-ER cells, but again were unable to A BC Fig. 2. Raf induces genes encoding enzymes with key functions in prostaglandin synthesis expression. (A) RafER3T3 cells were treated with 4-OHT and mRNA levels of PLA 2 , Cox-2, mPGES-1 and PGIS were determined by qPCR. Values represent the average of triplicates; error bars show the standard deviation. Significant differences from untreated cells are indicated by an asterisk (paired t-test: P < 0.05). (B) Analy- sis of Cox-1 and Cox-2 expression in 4-OHT treated RafER3T3 cells by northern blotting. Quantitative evaluation by PhosphoImaging showed that Cox-1 and PGIS mRNA levels did not fluctuate significantly during the time-course of the experiment. For a quantification of Cox-2 expression see (C). PGES mRNA was induced 4.7-fold at 16 h. (C) Analysis of Cox-2 induction in the presence of UO126 or actinomycin D. Shown is the quantitative evaluation of a northern blot (PhosphorImager). T. Fauti et al. Raf induction of PGI 2 synthesis in the absence of PPARb activation FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS 173 detect any induction of transcriptional activity, both in the presence and absence of a cotransfected PPARb expression vector (data not shown). Likewise, transcriptional activity was not increased by 4-OHT in cells transfected with a RXRa expression vector [26] and treated with the RXR agonist 9-cis retinoic acid (data not shown). These findings strongly suggest that the lack of PPARoad activation by Raf-induced PGI 2 in the Lex system described above is not a pecu- liarity of the experimental setup and is not due to a rate-limiting level of the obligatory PPAR heterodime- rization partner RXR. These observations are surpri- sing and indicate that, at least in the experimental systems used, PGI 2 may not act as agonist for PPARb. We therefore addressed this issue in further detail below. Effect of PGI 2 synthesis on PPARb Certain polyunsaturated fatty acids, such as AA and eicosapentaenoic acid (EPA) have been described to exert some agonistic effect on PPARb. This effect was also observed in the LexA-DBD based luciferase assay in the present study. An approximately 3-fold stimula- tion of the transcriptional activity o PPARb was seen with 10 lm AA, whereas EPA had a modest effect only at a higher concentration of 30 lm (Fig. 5A). Although the effect of AA was much weaker than that of the synthetic PPARb agonists carbaprostacyclin (cPGI) and GW501516, it was consistently and repro- ducibly seen. Treatment with AA resulted in an approximately sixfold increase in 6-k-PGF 1a in the cul- ture medium, and this increase could be completely blocked by the PGIS inhibitor U51605 [27] (Fig. 5B). U51605 also further reduced the low level of PGI 2 synthesis in the absence of AA by about threefold (Fig. 5B). Thus, the extent of PGI 2 synthesis varied over an overall range of nearly 15-fold, but no correlation with PPARb transcriptional activity was observed (Fig. 5B). Very similar results were obtained with the Cox inhibitors ASA and SC-58125 (data not shown). Next, we overexpressed Cox-2 and ⁄ or PGIS in HEK293 cells and monitored the effect on PGI 2 synthesis and PPARb transcriptional activity. As depicted in Fig. 6, transfection of Cox-2 or PGIS expression vectors alone only had a marginal effect on 6-k-PGF 1a levels in the culture medium, but cotransfection of both vectors resulted in an almost 100-fold increased PGI 2 synthesis, both in the A B Fig. 3. Raf induces PPARb gene expression. (A) RafER3T3 cells were treated with 4-OHT and PPARb mRNA levels were deter- mined by qPCR. Values represent the average of triplicates; error bars show the standard deviation. Significant differences from untreated cells are indicated by an asterisk (paired t-test: P < 0.005). (B) Analysis by northern blotting of PPARb induction in the presence of UO126 or actinomycin D. Shown is a quantitative evaluation of a northern blot by PhosphorImaging. Fig. 4. Induction of PPARb transcriptional activity by AA is not dependent on PGI 2 synthesis. (A) Stimulation of PPARb-LBD medi- ated transcriptional activity in NIH3T3 cells by polyunsaturated fatty acids and the synthetic agonists carbaprostacyclin (cPGI) and GW01516. For experimental details see legend to Fig. 6. Values represent the average of triplicates; error bars show the standard deviation. Significant differences from untreated cells are indicated by an asterisk (paired t-test: P ¼ 0.01). (B) Effect of the PGIS inhib- itor U51605 on 6-kPGF 1a accumulation in the cell culture superna- tant as a measure of PGI 2 synthesis (bar graph) and on PPARb-LBD mediated transcriptional activity (bottom row). PPAR activities are shown as the average of triplicates and standard deviation. Raf induction of PGI 2 synthesis in the absence of PPARb activation T. Fauti et al. 174 FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS absence and presence of exogenous AA. But again, this dramatic increase in PGI 2 synthesis has no inducing effect on the transcriptional activity of PPARb. Discussion In the present study, we used a 4-OHT inducible sys- tem (N-BxB-ER cells) [25] to investigate which com- ponents of the prostanoid signaling network are targets of Raf signaling. Our data show that C-Raf activation leads to a dramatic ERK-dependent induc- tion of Cox-2 transcription and to a modest increase in mPGES-1 and PGIS mRNA expression (Fig. 2). Induction of Cox-2 by Ras-dependent signaling, inclu- ding the ERK pathway, has previously been reported for several other experimental systems. Surprisingly, we did not find any induction of cPLA2, even though this gene has been described as a Ras target gene in lung epithelial cells [28,29]. It is therefore likely that Ras uses downstream effector pathways other than Raf-MEK-ERK to regulate the cPLA2 gene. In agreement with these observations, 4-OHT treatment of N-BxB-ER cells led to a dramatic increase in PGE 2 and PGI 2 synthesis, which, in keeping with a lack of cPLA 2 induction, could be substantially enhanced by adding AA to the growth medium (Fig. 1A). These data suggest that Raf oncogenes can contribute to tumorigenesis by augmenting the secre- tion of tumor growth promoting prostaglandins, such as PGE 2 . In the same experimental system, we also observed a clear induction of PPARb transcription upon Raf acti- vation (Fig. 3). PPAR b has been shown to play a role in diverse biological and biochemical processes, inclu- ding lipid metabolism, wound healing, placenta development and inflammation, but there is also con- siderable evidence suggesting a function for PPARb in oncogenesis [1,30]. This assumption is mainly based on observations made with PPARb null mice where an altered growth behavior of intestinal polyps was observed [13–15]. In spite of this central biological role for PPARb, the ligands that regulate its transcriptional activity in vivo remain largely obscure [31]. Polyunsatu- rated fatty acids, such as EPA, undoubtedly have an agonistic effect, but this is weak and not isoform speci- fic [32]. PGI 2 , an AA derivative formed by the succes- sive action of Cox and PGIS, has been suggested as a PPARb specific agonist [2,33,34]. Since 4-OHT induces both PGI 2 synthesis and PPARb expression in N-BxB- ER cells, we utilized this system to test whether Raf activation establishes an autocrine ⁄ intracrine signaling loop consistent with the notion of PGI 2 acting as PPARb agonist. Surprisingly, however, Raf activation did not lead to any detectable increase in PPARb transcriptional activity. This was seen with both a PPRE-tk reporter construct measuring total PPAR activity (data not shown) and with the b-isoform specific LexA-based system established in this study (Fig. 4). The same observation was made when an expression vector for RxRa was cotransfected (data not shown), indicating that the lack of activation by PGI 2 was not due to rate-limiting levels of the obligatory PPAR hetero- dimerization partner. These results clearly suggested that PGI 2 is not a PPARb agonist in this experimen- tal system (3T3 fibroblasts). We therefore performed several additional experiments that all confirm the A B Fig. 5. Overexpression of Cox-2 and PGIS does not induce PPARb transcriptional activity. HEK293 cells were transiently transfected with expression vectors for Cox-2, PGIS or both. Forty-eight hours later, PPARb-LBD mediated transcriptional activity and 6-kPGF 1a accumulation in the cell culture supernatant were determined. For experimental details see legend to Fig. 6. Values represent the average of triplicates; error bars show the standard deviation. Signi- ficant differences from untreated cells are indicated by an asterisk (paired t-test: P ¼ 0.01). T. Fauti et al. Raf induction of PGI 2 synthesis in the absence of PPARb activation FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS 175 conclusion that PGI 2 lacks agonistic activity for PPARb in vivo. The ectopic expression of Cox-2 and PGIS in HEK293 cells resulted in a dramatic induction of PGI 2 synthesis, but no increase in PPAR b transcrip- tional activity was observed (Fig. 6). This is in con- trast to a previously published observation made with the human osteosarcoma cell line U2OS [2]. The reason for this discrepancy is not clear since we were unable to reproduce the published results using in the identical experimental set-up (U2OS cells and Gal4-based reporter system; Tanja Fauti, unpublished data). Prostacyclin-mediated regulation of PPARb has also been claimed in another study using HEK293 cells [3]. In this study, a PPRE-SV40-pro- moter-luciferase construct was used as the reporter, raising the possibility that the observed transcrip- tional activation was mediated by a different PPAR or even by a PPAR-unrelated event, e.g. through sti- mulation of the SV40 promoter and ⁄ or via the PGI 2 membrane receptor IP. Unless supplemented by appropriate controls, these data therefore do not unequivocally show that PGI 2 can invoke a direct transcriptional activation of PPARb. The addition of pure PGI 2 (10 lm) to the culture medium of Chinese hamster ovary cells did not alter the transcriptional activity of PPARb to any significant extent (unpublished data). This is in agreement with two other previous studies. First, U2OS cells trans- fected with a PPARb reporter did not show any response to the addition of PGI 2 [35]. In a second study, the same result was obtained with CV1 cells [36]. Even though these results are in perfect agree- ment, they have to be considered with some caution since it is unclear how the biological instability of PGI 2 might affect these kinds of experiments. A weak agonistic effect was seen in 3T3 cells with exogenously supplied AA, but this increase in PPARb transcriptional activity was not influenced when PGI 2 synthesis was blocked by inhibitors of PGIS or Cox (Fig. 5). Taken together, our observations made with three different cell types and different experimental approaches provide no evidence that PGI 2 acts as a PPARb agonist. Interestingly, in spite of the failure of PGI 2 to acti- vate PPARb, the PGI 2 analog cPGI showed strong agonistic properties in all four cell lines analyzed (Fig. 5A; data not shown). It is possible that the subtle differences in the chemical structures of PGI 2 and cPGI have an unexpected effect on the ability to inter- act with PPARb. Alternatively, the half-life of PGI 2 may be too short to allow for a sufficient concentra- tion of intact molecules in transcription complexes in the nucleus. While a very short interaction with the PGI 2 membrane receptor (IP) may be sufficient for triggering a signal, a much greater stability may be required as a ligand of a nuclear receptor, where the presence of ligand may be necessary for an extended period of time. As expected, AA was able to activate PPARb activity, albeit at high concentrations (Fig. 5A). Even though high local concentrations of specific lipids can be achieved in vivo, so that there may be no need for a high affinity ligand, it is unclear whether AA itself can act as a PPARb agonist in vivo,or whether AA is converted to PPARb stimulatory metabolites by Cox-independent pathways. Further- more, the existence of totally unrelated high affinity PPARb agonists cannot be excluded at present. Fur- ther studies systematically addressing this are neces- sary to clarify this issue. Fig. 6. Raf induction does not activate PPARb transcriptional activ- ity. PPARb-LBD mediated transcriptional activity was determined in untreated and 4-OHT-treated RafER3T3 cells in the presence of 20 m M arachidonic acid. Cells were transiently transfected with an expression vector encoding the LexA-PPARb fusion protein (Lex- PPARb-LBD) or the empty vector (pcDNA3.1) together with a lexA- luciferase reporter plasmid (7 L-TATAi). Luciferase activity was determined 48 h after transfection; 4-OHT treatment was for 24 h. As a positive control, cells were also treated with 1 m M GW501516 for 24 h. Values represent the average of triplicates; error bars show the standard deviation. Significant differences from untreated cells are indicated by an asterisk (paired t-test: P < 0.003). Raf induction of PGI 2 synthesis in the absence of PPARb activation T. Fauti et al. 176 FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS Experimental procedures Chemicals Chemicals were purchased from the following companies: acetylsalicylic acid (Cayman Chemical Company, Ann Arbor, MI, USA), actinomycin D (Sigma-Aldrich, Tauf- kirchen ⁄ Munich, Germany), carbaprostacyclin (Cayman Chemical Company), GW501516 (Calbiochem ⁄ Merck Bio- sciences, Bad Soden, Germany), 4-hydroxy-tamoxifen (Sigma-Aldrich), PGI 2 (Alexis ⁄ AXXORA, Lausen, Switzer- land), SC-58125 (Calbiochem ⁄ Merck Biosciences), U51605 (Cayman Chemical Company), UO126 (Promega, Man- nheim, Germany). Cell culture NIH3T3, N-BxB-ER, HEK293 and CHO cells were cul- tured in DMEM supplemented with 10% fetal bovine serum, 100 UÆmL )1 penicillin and 100 lgÆmL )1 streptomy- cin. Cells were maintained in culture at 37 °C with 5% CO 2 in a humidified incubator. Plasmids PGIS-pcDNA3.1 and COX2-pcDNA3.1 were obtained by cloning the full-length human PGIS and Cox-2 cDNAs into the expression vector pcDNA3.1(+) (Invitrogen, Kahlsruhe, Germany). PPREx3-tk-pGL3 was constructed by inserting the PPRE 3 -TK-fragment from PPRE 3 -TK- LUC [36] (obtained from R.M. Evans, La Jolla, CA, USA) into the pGL3 basic luciferase vector (Promega). 7 L-TATAi has been described previously [37]. pcDNA3.1- LexA-PPARb-LBD was constructed as follows: the PPARb-LBD fragment flanked by a 5¢-AseI- and a-3¢ BamHI-site was synthesized by PCR using pCMX- mPPARb [36] as the template. The LexA-DBD fragment, including a Kozak and a nuclear localization sequence, was amplified from vWFnLexA by RT–PCR. The remain- ing LexA-fragment was flanked with a 5¢ HindIII- and a-3¢-NdeI-site. The fragments were cut with NdeI and AseI, ligated with T4 DNA ligase (Roche diagnostics), treated with Taq DNA polymerase to add 3¢ oligo(A) overhangs and cloned into pCRIITOPO (Invitrogen). Finally the LexA-PPARb-LBD fragment was cut with BamHI and HindIII and subcloned into pcDNA3.1 zeo (Invitrogen). RNA isolation RNA was isolated using the RNeasy TM kit from Qiagen (Hilden, Germany) following the manufacturer’s protocol. Briefly 30 lg of tissue were homogenized in 600 lL RLT buffer and 6 lL b-mercaptoethanol with a warring blender (Ultra-Thurrax; IKA, Staufen, Germany). Qia shredders (Qiagen) were used to break down genomic DNA of lysed tissue culture cells and homogenized tissue. Northern blotting RNA (5–20 lg) was mixed with sample buffer (0.5 mL 10 Mops buffer, 1.75 mL 37% formaldehyde, 5 mL forma- mide) and loading buffer (50% glycerol, 1 mm EDTA, 0.25% Bromophenol blue, water) and separated on a 1% agarose ⁄ formamide gels containing 2.2 m formaldehyde. The RNA was blotted to Hybond-N (Amersham, Freiburg, Germany) with 10 · NaCl ⁄ Cit and crosslinking under UV light (Stratalinker 2400, 254 nm, 1200 J m )2 ; Stratagene, La Jolla, CA, USA). Hybridization to P 32 -labeled probes was performed as described [25]. Signal intensites on mem- branes were quantitated by PhosphorImager (Fuji, Du ¨ ssel- dorf, Germany). Reverse transcriptase PCR cDNA was synthesized using 1 lg of RNA, oligo dT primers and reverse transcriptase according to the manufacturer’s protocol (Roche Diagnostics, Mannheim, Germany). PCR was performed for 25 cycles at an annealing temperature of 55 °C(PPARb) respective 58 °C(Cox-2) with Platinum Taq polymerase (Invitrogen) using primers obtained from MWG Biotech (Ebersberg, Germany) with the following sequences: Cox-2 forward, 5¢—CCTTCTCCAACCTCTCCTAC—3¢; Cox-2 reverse, 5¢—AGGGGGTGCCAGTGATAGAG—3 ¢; PPARb forward, 5¢—AAGAGGAGAAAGAGGAAG TGG—3¢; PPARb reverse, 5¢—ATTGAGGAAGAGGCTG CTGA—3¢; actin forward, 5¢—GATGATGATATCGCCGC GCTCGTCGTC—3¢; actin reverse, 5¢—GTGCCTCAGGG CAGCGGACCGCTCA—3¢. Quantitative PCR Quantitative PCR was performed in a Mx3000P Real-Time PCR system (Stratagene) for 45 cycles at an annealing tem- perature of 57 °C. PCR reactions were carried out using the Absolute QPCR SYBR Green Mix (Abgene, Hamburg, Germany) and a primer concentration of 0.2 lm following the manufacturer’s instructions. The following primers MWG Biotech were used: actin forward, 5¢—AGAGGGA AATCGTGCGTGAC—3¢; actin reverse, 5¢—CAATAGTG ATGACCTGGCCGT—3¢; PPARb forward, 5¢—GTCGCA CAACGCTATCC—3¢; PPARb reverse, 5¢—CTCCGGGCC TTCTTTTTGGTCA—3¢; cPLA2 forward, 5¢—CATAAGT TTACTGTTGTGGTTCTA—3¢; cPLA2 reverse, 5 ¢—AGT GTCTCGTTCGCTTCC—3¢; COX-2 forward, 5¢—CCATG GGTGTGAAGGGAAATAA—3¢; COX-2 reverse, 5¢—TTG AAAAACTGATGGGTGAAG—3¢; mPGES-1 forward, 5¢—GGTGGCCCAGGAAGGAGACAGC—3¢; reverse 5¢—TGGCCTTCATGGGTGGGTAATA—3¢. T. Fauti et al. Raf induction of PGI 2 synthesis in the absence of PPARb activation FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS 177 Transient tansfections and luciferase assays Transfections were performed with polyethylenimine (PEI, average MW 25 000; Sigma-Aldrich). For each assay, 10 5 cells were transfected in DMEM plus 2% FCS with 5 lgof plasmid DNA and 5 lLofa1⁄ 1000 PEI dilution (adjusted to pH 7.0) preincubated for 15 min in 100 lL NaCl ⁄ P i for complex formation. Four hours after transfection, the med- ium was changed and cells were incubated in normal growth medium for 24 h. Luciferase assays were performed as des- cribed [38]. Values from three independent experiments were combined to calculate averages and standard deviations. Sample preparation for prostanoids by GC ⁄ MS ⁄ MS-analysis Samples were prepared as described [39] with minor modifi- cations. Briefly, cell culture supernatants were spiked with 10 ng of deuterated internal standards, and solvent was removed. The methoxime was obtained through reaction with an O-methylhydroxylamine hydrochloride-acetate buffer. After acidification to pH 3.5, prostanoid derivatives were extracted, and the pentafluorobenzylesters were formed. Samples were purified by TLC and two broad zones with R v 0.03–0.39 and 0.4–0.8 were eluted. After withdrawal of the organic layers, trimethylsilyl ethers were prepared by reaction with bis(trimethylsilyl)-trifluoroaceta- mide and thereafter subjected to GC ⁄ MS ⁄ MS analysis. GC ⁄ MS ⁄ MS analysis A Finnigan (Thermo Electron Corp., Dreieich, Germany) MAT TSQ700 GC ⁄ MS ⁄ MS equipped with a Varian (Palo Alto, CA, USA) 3400 gas chromatograph and a CTC A200S autosampler was used [39]. Acknowledgements We are grateful to Margitta Alt and Bernhard Watzer for excellent technical assistance. This work was sup- ported by the Wihelm-Sander-Stiftung, the Dr Mildred Scheel Stiftung and the Deutsche Forschungsgemeinsc- haft (SFB-TR17). References 1Mu ¨ ller R (2004) Crosstalk of oncogenic and prostanoid signaling pathways. J Cancer Res Clin Oncol. 130, 429– 444. 2 Gupta RA, Tan J, Krause WF, Geraci MW, Willson TM, Dey SK & DuBois RN (2000) Prostacyclin- mediated activation of peroxisome proliferator-activated receptor delta in colorectal cancer. Proc Natl Acad Sci USA 97, 13275–13280. 3 Hatae T, Wada M, Yokoyama C, Shimonishi M & Tanabe T (2001) Prostacyclin-dependent apoptosis mediated by PPAR delta. J Biol Chem 276, 46260–46267. 4 Lim H & Dey SK (2002) A novel pathway of prostacy- clin signaling-hanging out with nuclear receptors. Endo- crinology 143, 3207–3210. 5 Cutler NS, Graves-Deal R, LaFleur BJ, Gao Z, Boman BM, Whitehead RH, Terry E, Morrow JD & Coffey RJ (2003) Stromal production of prostacyclin confers an antiapoptotic effect to colonic epithelial cells. Cancer Res 63, 1748–1751. 6 Amano H, Hayashi I, Endo H, Kitasato H, Yamashina S, Maruyama T, Kobayashi M, Satoh K, Narita M, Sugimoto Y, Murata T, Yoshimura H, Narumiya S & Majima M (2003) Host prostaglandin E(2)-EP3 signal- ing regulates tumor-associated angiogenesis and tumor growth. J Exp Med 197, 221–232. 7 Sonoshita M, Takaku K, Sasaki N, Sugimoto Y, Ush- ikubi F, Narumiya S, Oshima M & Taketo MM (2001) Acceleration of intestinal polyposis through prostaglan- din receptor EP2 in Apc (Delta 716) knockout mice. Nat Med 7, 1048–1051. 8 He TC, Chan TA, Vogelstein B & Kinzler KW (1999) PPARdelta is an APC-regulated target of nonsteroidal anti-inflammatory drugs. Cell 99, 335–345. 9 Di-Poi N, Tan NS, Michalik L, Wahli W & Desvergne B (2002) Antiapoptotic role of PPARbeta in keratino- cytes via transcriptional control of the Akt1 signaling pathway. Mol Cell 10, 721–733. 10 Mao-Qiang M, Fowler AJ, Schmuth M, Lau P, Chang S, Brown BE, Moser AH, Michalik L, Des- vergne B, Wahli W, Li M, Metzger D, Chambon PH, Elias PM & Feingold KR (2004) Peroxisome-prolifera- tor-activated receptor (PPAR)-gamma activation sti- mulates keratinocyte differentiation. J Invest Dermatol 123, 305–312. 11 Kim DJ, Bility MT, Billin AN, Willson TM, Gonzalez FJ & Peters JM (2005) PPARbeta/delta selectively induces differentiation and inhibits cell proliferation. Cell Death Differ doi:10.1038/sj.cdd.4401713. 12 Park BH, Vogelstein B & Kinzler KW (2001) Genetic disruption of PPARdelta decreases the tumorigenicity of human colon cancer cells. Proc Natl Acad Sci USA 98, 2598–2603. 13 Barak Y, Liao D, He W, Ong ES, Nelson MC, Olefsky JM, Boland R & Evans RM (2002) Effects of peroxi- some proliferator-activated receptor delta on placenta- tion, adiposity, and colorectal cancer. Proc Natl Acad Sci USA 99, 303–308. 14 Harman FS, Nicol CJ, Marin HE, Ward JM, Gonzalez FJ & Peters JM (2004) Peroxisome proliferator-acti- vated receptor-delta attenuates colon carcinogenesis. Nat Med 10, 481–483. 15 Gupta RA, Wang D, Katkuri S, Wang H, Dey SK & DuBois RN (2004) Activation of nuclear hormone Raf induction of PGI 2 synthesis in the absence of PPARb activation T. Fauti et al. 178 FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS receptor peroxisome proliferator-activated receptor-delta accelerates intestinal adenoma growth. Nat Med 10, 245–247. 16 Hao CM, Redha R, Morrow J & Breyer MD (2002) Peroxisome proliferator-activated receptor delta activation promotes cell survival following hypertonic stress. J Biol Chem 277, 21341–21345. 17 Keith RL, Miller YE, Hoshikawa Y, Moore MD, Gesell TL, Gao B, Malkinson AM, Golpon HA, Nemenoff RA & Geraci MW (2002) Manipulation of pulmonary prostacyclin synthase expression prevents murine lung cancer. Cancer Res 62, 734–740. 18 Shaw N, Elholm M & Noy N (2003) Retinoic acid is a high affinity selective ligand for PPAR-beta ⁄ delta. J Biol Chem 278, 41589–41592. 19 Westergaard M, Henningsen J, Svendsen ML, Johan- sen C, Jensen UB, Schroder HD, Kratchmarova I, Berge RK, Iversen L, Bolund L, Kragballe K & Kristiansen K (2001) Modulation of keratinocyte gene expression and differentiation by PPAR-selective ligands and tetradecylthioacetic acid. J Invest Dermatol 116, 702–712. 20 Tan NS, Michalik L, Noy N, Yasmin R, Pacot C, Heim M, Fluhmann B, Desvergne B & Wahli W (2001) Criti- cal roles of PPAR beta ⁄ delta in keratinocyte response to inflammation. Genes Dev 15, 3263–3277. 21 Schmuth M, Haqq CM, Cairns WJ, Holder JC, Dorsam S, Chang S, Lau P, Fowler AJ, Chuang G, Moser AH, Brown BE, Mao-Qiang M, Uchida Y, Schoonjans K, Auwerx J, Chambon P, Willson TM, Elias PM & Fein- gold KR (2004) Peroxisome proliferator-activated recep- tor (PPAR)-beta ⁄ delta stimulates differentiation and lipid accumulation in keratinocytes. J Invest Dermatol 122, 971–983. 22 Kim DJ, Murray IA, Burns AM, Gonzalez FJ, Perdew GH & Peters JM (2005) Peroxisome proliferator-acti- vated receptor-beta ⁄ delta inhibits epidermal cell prolifer- ation by down-regulation of kinase activity. J Biol Chem 280, 9519–9527. 23 Kerkhoff E & Rapp UR (1998) Cell cycle targets of Ras ⁄ Raf signalling. Oncogene 17, 1457–1462. 24 Chang F, Steelman LS, Shelton JG, Lee JT, Navolanic PM, Blalock WL, Franklin R & McCubrey JA (2003) Regulation of cell cycle progression and apoptosis by the Ras ⁄ Raf ⁄ MEK ⁄ ERK pathway (Review). Int J Oncol 22, 469–480. 25 Kerkhoff E, Houben R, Loffler S, Troppmair J, Lee JE & Rapp UR (1998) Regulation of c-myc expression by Ras ⁄ Raf signalling. Oncogene 16, 211–216. 26 Shi Y, Hon M & Evans RM (2002) The peroxisome proliferator-activated receptor delta, an integrator of transcriptional repression and nuclear receptor signal- ing. Proc Natl Acad Sci USA 99, 2613–2618. 27 Gorman RR, Hamilton RD & Hopkins NK (1979) Sti- mulation of human foreskin fibroblast adenosine 3¢: 5¢-cyclic monophosphate levels by prostacyclin (prosta- glandin I2). J Biol Chem 254, 1671–1676. 28 Heasley LE, Thaler S, Nicks M, Price B, Skorecki K & Nemenoff RA (1997) Induction of cytosolic phospho- lipase A2 by oncogenic Ras in human non-small cell lung cancer. J Biol Chem 272, 14501–14504. 29 Blaine SA, Wick M, Dessev C & Nemenoff RA (2001) Induction of cPLA2 in lung epithelial cells and non- small cell lung cancer is mediated by Sp1 and c-Jun. J Biol Chem 276, 42737–42743. 30 Michalik L, Desvergne B & Wahli W (2004) Peroxi- some-proliferator-activated receptors and cancers: com- plex stories. Nat Rev Cancer 4, 61–70. 31 Bishop-Bailey D & Wray J (2003) Peroxisome prolifera- tor-activated receptors: a critical review on endogenous pathways for ligand generation. Prostaglandins Other Lipid Mediat 71, 1–22. 32 Forman BM, Tontonoz P, Chen J, Brun RP, Spiegel- man BM & Evans RM (1995) 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell 83, 803–812. 33 Lim H, Gupta RA, Ma WG, Paria BC, Moller DE, Morrow JD, DuBois RN, Trzaskos JM & Dey SK (1999) Cyclo-oxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARdelta. Genes Dev 13, 1561–1574. 34 Shao J, Sheng H & DuBois RN (2002) Peroxisome pro- liferator-activated receptors modulate K-Ras-mediated transformation of intestinal epithelial cells. Cancer Res 62, 3282–3288. 35 YuK, Bayona W, Kallen CB, Harding HP, Ravera CP, McMahon G, Brown M & Lazar MA (1995) Differential activation of peroxisome proliferator-activated receptors by eicosanoids. J Biol Chem 270, 23975–23983. 36 Forman BM, Chen J & Evans RM (1997) Hypolipi- demic drugs, polyunsaturated fatty acids, and eicosa- noids are ligands for peroxisome proliferator-activated receptors alpha and delta. Proc Natl Acad Sci USA 94, 4312–4317. 37 Nettelbeck DM, Jerome V & Muller R (1999) A dual specificity promoter system combining cell cycle-regu- lated and tissue-specific transcriptional control. Gene Ther 6, 1276–1281. 38 Gehrke S, Jerome V & Muller R (2003) Chimeric tran- scriptional control units for improved liver-specific transgene expression. Gene 322, 137–143. 39 Schweer H, Watzer B & Seyberth HW (1994) Determi- nation of seven prostanoids in 1 ml of urine by gas chromatography-negative ion chemical ionization triple stage quadrupole mass spectrometry. J Chromatogr 652, 221–227. T. Fauti et al. Raf induction of PGI 2 synthesis in the absence of PPARb activation FEBS Journal 273 (2006) 170–179 ª 2005 The Authors Journal compilation ª 2005 FEBS 179 . Induction of PPARb and prostacyclin (PGI 2 ) synthesis by Raf signaling: failure of PGI 2 to activate PPARb Tanja Fauti 1 , Sabine. above. Effect of Raf activation on the transcriptional activity of PPARb The simultaneous upregulation of PGI 2 synthesis and PPARb expression suggested the induction