Báo cáo " Calibration and verification of a hydrological model using event data " ppt

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc

... by means of mathematical models with varying degrees of detail. A primary advantage of a detailed, biochemically formulated model is that a one-to-one comparison can be made between model and ... Online Cellular Systems Modelling Database and can be accessed free of charge at http://jjj.biochem. sun.ac.za/database/hynne/index.html, http://jjj.biochem.sun.ac.za/database/d...

Ngày tải lên: 07/03/2014, 11:20

16 492 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantia nigra is a neuropathological hallmark of Parkinson’s disease. This leads to a decreased level of dopamine in the striatum. As a result, synaptic transmission is nega- tively affected ... and C) and MPP + (B and D) were analysed by SDS ⁄ PAGE (A and B) on 5–15% crosslinked polyacrylamide gel and western blotting (C and D). (A, B) Lane M, prestained molecular...

Ngày tải lên: 14/02/2014, 19:20

11 754 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Ada...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... Free ligands were adsorbed on charcoal, and the absorbance spectra were recorded. Concentration of appearing IF–CNCbl was calculated by comparison with the standards IF–H 2 OCbl and IF–CNCbl according ... and fixation of the ligands by IF. Dissociation of IF–CBC was biphasic, and existence of multiple protein–analogue complexes with normal and partially corrupted structure ma...

Ngày tải lên: 19/02/2014, 05:20

12 603 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AA GATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACG...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx

Báo cáo Y học: Overexpression of a recombinant wild-type and His-tagged Bacillus subtilis glycine oxidase in Escherichia coli pptx

... multicomponent buffer (see Materials and methods) and the n assayed usin g the stand ard O 2 consumption assay at 25 °C. Data are exp ressed as per cent of enzyme activity in the standard assay; th e lines ... glycine and formalde- hyde. Similarly, DAAO catalyses the oxidative d eamination of neutral and (with a lower efficiency) basic D -amino acids to give the corresponding a...

Ngày tải lên: 08/03/2014, 16:20

8 482 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

... (forward, 5¢-AAG GCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACA GGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco (forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢; reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulin- specific ... adjacent to the ATG start codon and SacI downstream of the TAA stop codon for easy cloning in the forward and reverse primers, respectively (forward, 5¢-ctc gag ATG AAG...

Ngày tải lên: 16/03/2014, 06:20

16 454 0
Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

... 5’-GC TCTAGAATCTACAAACCTAAAACAAC-3’ XbaI stkP deletion DFKRP 5’-TGC CCGCGGTCATAATATCACGGACCGCAT-3’ SacII stkP deletion CAT1 5’-CGC GGATCCGAAAATTTGTTTGATTTTTAA-3’ BamHI stkP replacement CAT2 5’-GC TCTAGAAAGTACAGTCGGCATTAT-3’ ... Purpose STKP-F 5’-AGGATGC CATATGATCCAAATCGGCAA-3’ NdeI stkP expression STKP-R 5’-TTGATTAT GAATTCGCTTTTAAGGAGTAGC-3’ EcoRI stkP expression STKP-RT 5’-GTAGGACA GAATTCAAG...

Ngày tải lên: 16/03/2014, 18:20

12 466 0
Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf

Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf

... displayed a single broad band in the 70±75 kDa molecular mass range. In contrast, the puri®ed plasma BChE showed a faint band at 170 kDa (nonreducible dimer) and a major broad band at 85 kDa (monomer) under ... L., Velan, B., Lazar, A. , Kronman, C., Barak, D., Ariel, N., Shaerman, A. , Silman, I. & Sussman, J.L. (2000) Structures of r ecombinan t native and E202Q mutant h...

Ngày tải lên: 17/03/2014, 11:20

8 473 0
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

... emergency medical call centre organization reform in Finland. Material and methods A retrospective observational study was conducted in the EMCC in East and Central Uusimaa, an area of southern Finland ... data that could allow for a struc- tured evaluation of the organizational changes. It is evi- dent that a well-planned evaluation of changes in the organizations, before t...

Ngày tải lên: 25/10/2012, 10:02

5 496 0
w