Diary of a Nursing Sister on the Western Front, 1914-1915 pptx
... Sister on the Western by Anonymous 19 Diary of a Nursing Sister on the Western by Anonymous The Project Gutenberg EBook of Diary of a Nursing Sister on the Western Front, 1914-1915, by Anonymous ... file was produced from images generously made available by The Internet Archive/Canadian Libraries) Diary of a Nursing Sister on the...
Ngày tải lên: 07/03/2014, 01:20
... measure. In addition, conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is that they focus on the estimation of cash flows and ... Description of measure Human Capital Intelligence (Fitz-Enz, 1994) Sets of human capital indicators are collected and bench-marked against a database. Similar to HRCA. Skandia...
Ngày tải lên: 20/12/2013, 17:15
... NRG-5¢_for NRG-Beta_rev TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC 677 GAPDH GAPDH_for GAPDH_rev GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT 450 Fig. 2. Proteolytical processing of APP and NRG-1 in U373 ... NRG-jD_for NRG-TM_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC Approximately 200 (depending on isoform) Immunoglobulin domain (type I and II) NRG-IG_for NRG-TM_rev GCCAGGGAAGT...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc
... spectra of the GGN4 analogues, including the native GGN4, showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly random-coil conformation with ... also significantly increased the antimicrobial activity of the peptide. However, a remarkable increase of the hemolytic activity was observed concomitantly. Conformationa...
Ngày tải lên: 31/03/2014, 09:20
all quiet on the western front
... million and a half copies its first year in print, and was translated into 29 languages. All Quiet on the Western Front is known as one of the literary masterpieces of the twentieth century. Remarque ... for Paul. The boys are ravaged by mustard gas, bombs, grenades, rifle shots, and shrapnel in the horrible attacks suffered by the front line. When the characters are i...
Ngày tải lên: 21/03/2014, 21:55
movie all quiet on the western front
... Paul is drawing a picture of a bird. In Paul's family they are glad that he is going to war. His family prays for him and they pray for the Kaiser, the ruler of Germany. We see here that ... with the war. Paul is changed emotionally by this and he is sad about it. After the boys see the Kaiser they talk and don't even know what they are fighting for. One night in b...
Ngày tải lên: 21/03/2014, 22:09
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... International Energy & Environment Foundation. All rights reserved. A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient air- breathing ... adequate membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2]. Water management is related with air supply to...
Ngày tải lên: 05/09/2013, 14:58
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... view of the firm, as an overall change process and a form of organisational renewal, focused on innovation, through the creation, transmission and application of new knowledge (Cohen and Levinthal, ... of the environment, markets and customers. The second fundamental aspect in the Irizar strategy was that of shared leadership. The idea that the best organizations do...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu A Historical Primer on the Business of Credit Ratings docx
... owners of financial assets, the institutions (both public and private) that guarantee the assets, and the asset managers that act as agents for the principals or owners. An asset manager, for example, ... business that has accompanied the globalization of capital markets since the 1970s, with some discussion of various rationales or explanations of continuing importanc...
Ngày tải lên: 16/02/2014, 03:20