the saturated vapour pressure of a liquid depends on what

... view the log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data ... described here was supported in part by the Na- tional Science Foundation under grant CCR-8900029, and in part by the National Aeronautics and Space Administration and the Defense Advanced Research Projects ... home of the data. Rather than redoing the operation to the separate data copy, Sprite LFS recovery insures that the indexes point at the newest copy of the data in the log. Collecting data in the...

Ngày tải lên: 12/09/2012, 15:05

Ngày tải lên: 05/09/2013, 16:11

Ngày tải lên: 05/09/2013, 16:11

Ngày tải lên: 07/09/2013, 13:48

... fact that these indicators are much easier to measure. In addition, conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is that ... sophisticated information systems and data warehouses been able to manage a great deal of data. The challenge is to capture and measure soft and qualitative information. For example, in the book The Experience ... financial and non- financial measures and gives the adequate importance to human relationships and intangible assets. This cross-functional approach should establish linkages among the metrics, shaping...

Ngày tải lên: 20/12/2013, 17:15

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... pattern, the theme-rheme pattern, the grammatical and lexical cohesion analyses for the cohesive harmony of the text; to a summary of the context of situation of the text in terms of the ... paper, an attempt is made to explore the grammar and meaning of a science fiction story as a text. The procedures and conventions used in the analysis are based on the framework of Halliday’s...

Ngày tải lên: 12/02/2014, 20:20

... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... total protein )1 ặh )1 . Localization of zebrash RPE65c in the retina and its subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody ... chromophore. Isomerization of 11cRAL to all-trans retinal (atRAL) by a photon induces a conformation change of the visual pigments, triggers the phototransduction cascade and initiates vision [1,2]. The retinoid...

Ngày tải lên: 14/02/2014, 14:20

... Protein concentration was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from ... they can increase the amount of available phosphate by interacting together. Additionally, fusing PhyH-DI to a single-domain phytase appears to be an efficient way to improve the activity of the ... was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 min when assayed at 35 °C (Fig. 3A, B). The presence of Ca 2+ increased the thermal stability of PhyH and...

Ngày tải lên: 14/02/2014, 15:20

... Peninsula Gulf of Oman U .A. E. Russian Federation Muskat Angola Luanda Congo Cabinda Argentina Chile Rio Grande Atlantic Ocean Pacific Ocean Estonia Latvia Lithuania Belarus Poland Riga Kaliningrad ... East Pakistan. The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation. 284 Clearly, while Pakistan had been non-contiguous, ... passage between Gaza and the West Bank might claim that the Bangladesh Liberation War and the secession of East Pakistan was the result of non-contiguity between East Pakistan and West Pakistan....

Ngày tải lên: 16/02/2014, 11:20

... Bento I, Matias PM, Catarino T, Baptista AM, Soares CM, Carrondo MA, Turner DL & Xavier AV (2001) Conformational component in the coupled transfer of multiple electrons and protons in a monomeric tetraheme ... Marquardt method for parameter optimization. The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed ... solution at pH 7.0: indigo tetrasulfonate, indigo trisulfonate, indigo disulfonate, anthraquinone-2-7-disulfonate, anthraquinone- 2-sulfonate, safranine O, diquat, neutral red, phenosafranine, and...

Ngày tải lên: 19/02/2014, 17:20

... its deadline will be met, based on the published parameters of each schedulable operation. One advantage of our approach is that operation invoca- tions only pay the overhead of the C++ virtual ... Facade Sensor Proxy Sensor Proxy Sensor Proxy Sensor Proxy I/O Facade I/O Facade 2: Demarshaled data High Level Abstraction Low Level Abstraction 1: I/O via interrupts Aircraft Sensors Figure 4: Example Avionics Mission Control Application ample has the ... configuration and an- other measured the utilization of a federated Event Channel configuration. 6.1.1 Single Event Channel Utilization The first experiment used a single Event Channel that was collocated...

Ngày tải lên: 19/02/2014, 18:20

... with the negatively charged Asp113 at distance of 3.2 A ˚ . One of the reasons that the pK a of His210 is 2 pH units higher than that of His57 is the buried charge interaction with Asp113. The ... struc- tural deviation, the solvent ASA of the side-chain of His210 increased with the decrease in size of the side-chain at residue 169 (Table 1 and Fig. 3A) . However, the ASAs of Asp113 and His57 ... kshiraki@jaist.ac.jp Abbreviations:API,Achromobacter protease I; ASA, accessible surface area; Boc, t-butoxycarbonyl; MCA, 4-methylcoumaryl-7-amide; VLK-MCA, Boc-Val-Leu-Lys-MCA. Enzyme: Achromobacter...

Ngày tải lên: 21/02/2014, 03:20

... exists a very neat characterization of nef classes on arbitrary surfaces, Kăahler or not. The Main Theorem has an important application to the deformation the- ory of compact Kăahler manifolds, ... characterization of the Kăahler cone of a compact Kăahler manifold By Jean-Pierre Demailly and Mihai Paun NUMERICAL CHARACTERIZATION OF THE K ă AHLER CONE 1271 Here the stars indicate ... in a nonsingular ambient space for X, and a nef class is a NUMERICAL CHARACTERIZATION OF THE K ă AHLER CONE 1251 of N. Buchdahl [Buc99, 00] and A. Lamari [Lam9 9a, 99b]; it turns out that there...

Ngày tải lên: 05/03/2014, 23:20

... form of proHP8 Xa and the catalytic domain of active HP8 are marked with arrowheads. The size and position of molecular weight stan- dards are indicated on the left. (B) The catalytic activity of ... Ile-Glu-Ala-Arg-p-nitro- anilide (IEARpNA) [31]. ProHP8 Xa lacked IEARase activity, but after the zymogen was activated by factor Xa, IEARase activity increased significantly above that of factor Xa alone, which could also ... (1988) Isolation and characterization of the human Gs alpha gene. Proc Natl Acad Sci USA 85, 2081–2085. 42 Quan F & Forte MA (1990) Two forms of Drosophila melanogaster Gs alpha are produced by alternate...

Ngày tải lên: 06/03/2014, 09:22

... group responded, “They’re [the attacks are] actually brain-dead!” The group emphasized that although the attacks may look sophisticated to a “traditional” analyst, the next genera- tion of analysts ... in white. Another view of an attacker model is that the insider has certain attributes that are perhaps measurable. Attacks have certain observables, and the type of outcome can be placed in several categories. ... non-cyber attacks are possible on the database of requirements; and indications and warning of attacks on requirements could be derived from database audit logs. Collection The collection process was...

Ngày tải lên: 06/03/2014, 16:20

... You can't realise that it has all been done on purpose, and that none of them are accidents or surgical diseases. And they seem all to take it as a matter of course; the bad ones who are conscious ... makes a very light load from the point of view of work, but we shall have them on the train all night. One of us is doing all the train half the night, and another all the train the other half. ... where, when, and what one could get; one wash only on a station platform at a tap which a sergeant kindly pressed Diary of a Nursing Sister on the Western by Anonymous 15 We have got our baggage (kit-bags...

Ngày tải lên: 07/03/2014, 01:20

... pKP1500. The forward p rimer 5Â-ATGACTATTTCTTCTGCACAT CCAGAGACAGAAC-3Â con tains the initiation codon, while the reverse primer 5Â-CTTTCTGCAGACTCA TTCGCTGATATATATTC-3Â linked a PstI restriction site to ... a- 1,4 and a- 1,6. McCarter and Withers [26] indicated that Asp214 on the consensus region II of maltase is the catalytic nucleophile. Because the Asp214 of maltase is equivalent to the Asp215 of ... then one da y later several b lue colonies appeared. One of the clones expressing isomaltase was selected. The plasmid containing the isomaltose gene was designated pYIM. Cloning of the maltase...

Ngày tải lên: 07/03/2014, 16:20

... without a speci- fic assumption on parameter perturbations for each network node. Based on these equations, we further describe the available specific information from each part of experimental data ... parameter perturbations. All these approaches are based on parameter perturbation experiments which are, however, not always achievable in many practical cases. In this paper, we therefore consider ... can be applied to any larger cases in the AB Fig. 5. Temporal expression profiles (A) and a summary of the analysis results (B) for the artificial example system. The small circle points on each...

Ngày tải lên: 07/03/2014, 21:20

Ngày tải lên: 15/03/2014, 00:20

Ngày tải lên: 16/03/2014, 04:20