... NANO EXPRESS The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot Gabriele Raino ` ặ Giuseppe Visimberga ặ Abdelmajid Salhi ặ Maria T. Todaro ặ Massimo ... performed on the sample. To reduce the probed area we coated a quartz wafer with a photolitho- graphically defined Ti/Au layer containing an array of widely spaced holes of 200 lm which could be placed metal ... temperature the thermal escape becomes the main non-radiative process. Figure 3 shows a comparison among the time evolutions of the different emission peaks observed in the cw-PL spectrum on a time scale...
Ngày tải lên: 22/06/2014, 18:20
... fact that these indicators are much easier to measure. In addition, conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is that ... sophisticated information systems and data warehouses been able to manage a great deal of data. The challenge is to capture and measure soft and qualitative information. For example, in the book The Experience ... financial and non- financial measures and gives the adequate importance to human relationships and intangible assets. This cross-functional approach should establish linkages among the metrics, shaping...
Ngày tải lên: 20/12/2013, 17:15
Diary of a Nursing Sister on the Western Front, 1914-1915 pptx
... You can't realise that it has all been done on purpose, and that none of them are accidents or surgical diseases. And they seem all to take it as a matter of course; the bad ones who are conscious ... makes a very light load from the point of view of work, but we shall have them on the train all night. One of us is doing all the train half the night, and another all the train the other half. ... and N.C.O.'s are just the same, and always awfully grateful if you can help them out with the language in any way. This was a conversation I heard in my ward to-day. Brother of Captain (wounded)...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... the reaction mechanism of a bacterial ATP-citrate lyase Tadayoshi Kanao, Toshiaki Fukui, Haruyuki Atomi and Tadayuki Imanaka Department of Synthetic Chemistry and Biological Chemistry, Graduate ... case of Ec-SCS [21], although the phos- phorylation of the a- subunit alone (80% of the subunit after 24 h) was much slower than AclA alone (90 min). A major contribution of AclB, as well as the ... products, AclA (a subunit) and AclB (b subunit). By comparing the primary structures of AclA and AclB with that of the mammalian enzyme, we found that AclA and AclB Correspondence to T. Imanaka, Department...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... photon densities, we vary one of parameters in table 1 and remain invariable all the rest of parameters. The obtained results are shown in Section 3. 3. Influences of laser parameters on saturated ... Science, Mathematics - Physics 23 (2007) 139-142 139 Influence of laser parameters on the stationary operation of a two-mode random micro laser Dinh Van Hoang * , Mai Hong Hanh Department of Physics, ... stationary operation of a two-mode random microlaser we have found the transformation of saturated values of mode intensity when laser parameters as gain and loss coefficients as well as field...
Ngày tải lên: 14/03/2014, 13:20
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... of a drop U of minimal generation. It then follows the boundary of U along a nontrivial arc I. Finally, it returns along the boundaries of another chain of descendants of U until it reaches a ... is the theorem of David on integrability of certain Beltrami differentials with unbounded dilatation [Da]. David’s integrability condition requires that for all large K, the area of the set of ... P θ for almost every irrational θ satisfying the above Brjuno-Yoccoz condition: Theorem A. Let E denote the set of irrational numbers θ = [a 1 ,a 2 ,a 3 , ] which satisfy the arithmetical condition log...
Ngày tải lên: 14/03/2014, 22:20
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... NRG-5Â_for NRG -a_ rev TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG 668 b NRG-5Â_for NRG-Beta_rev TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC 677 GAPDH GAPDH_for GAPDH_rev GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT 450 Fig. ... Universita ă t Darmstadt, Germany) was applied at a concentration of 2 lm . GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma, ... NRG-1, on the other hand, was impaired in fibroblasts with catalytically inactive ADAM17 [30]. b- and c-secretase are responsible for processing of the Alzheimer associated APP and its paralogues amy- loid...
Ngày tải lên: 16/03/2014, 04:20
Changing only the aesthetic features of a product can affect its apparent usability pptx
... participants rated the aesthetics and usability of each of model, then used them, then rated them again for both aesthetics and usability. The order of rating (usability-aesthetics or aesthetics-usability) ... Hassenzahl's [7] model assumes that when a participant in an experiments is asked to rate a design they imagine themselves in a particular situation and make some evaluation of Apparent ... this manipulation will also affect its pragmatic attributes supporting a holistic view of the evaluation of hedonic and pragmatic attributes in the perception of Apparent Product Character...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc
... D16W-D 24)37 GGN4, a GGN4 analogue with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native ... facilitate the amphipathic interaction between the peptide and the membrane surface, as the tryptophan side chain is amphiphilic in nature. The tryptophan side chain conformation was more clearly defined ... respectively. The direction of view is approximately perpen- diculartothehelicalaxisinpanelsAandB, and is parallel to the helical axis in panels C and D. Ó FEBS 2002 Structure–activity relationships of...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo toán học: " Shrinking projection algorithms for equilibrium problems with a bifunction defined on the dual space of a Banach space" doc
... applications. In: Kartsatos AG (ed.) Theory and Applications of Nonlinear Operators of Monotonic and Accretive Type. pp. 15–50. Dekker:New York (1996) 17. Takahashi, W: Nonlinear Functional Analysis-Fixed ... solutions of an equilibrium problem and the set of fixed points of a relatively nonexpansive mapping in Banach spaces. Ibaraki and Taka- hashi [10] introduced a new resolvent of a maximal monotone ... operator in Banach spaces and the concept of the generalized nonexpansive mapping in Banach spaces. Honda et al. [11], Kohsaka and Takahashi [12] also studied some properties for the gen- eralized...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx
... Access On the maximum modulus of a polynomial and its polar derivative Ahmad Zireh Correspondence: azireh@shahroodut.ac.ir Department of Mathematics, Shahrood University of Technology, Shahrood, Iran Abstract For ... Rather, NA: A refinement of a theorem of Paul Turan concerning polynomials. Math Ineq Appl. 1, 231–238 (1998) 7. Jain, VK: Generalization of an inequality involving maximum moduli of a polynomial and ... derivative. J Approx Theory. 54, 306– 313 (1988). doi:10.1016/ 0021-9045(88)90006-8 5. Shah, WM: A generalization of a theorem of Paul Turan. J Ramanujan Math Soc. 1,67–72 (1996) 6. Aziz, A, Rather,...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... this article as: Bae and Park: A fixed-point approach to the stability of a functional equation on quadratic forms. Journal of Inequalities and Applications 2011 2011:82. Bae and Park Journal of ... a functional equation on quadratic forms Jae-Hyeong Bae 1 and Won-Gil Park 2* * Correspondence: wgpark@mokwon.ac.kr 2 Department of Mathematics Education, College of Education, Mokwon University, Daejeon, ... functional equation having quadratic forms as solutions. J Inequal Appl 2007 (2007). Article ID 24716 11. Rassias, TM: On the stability of linear mappings in Banach spaces. Proc Amer Math Soc....
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " A note on the Königs domain of compact composition operators on the Bloch space" doc
... article as: Jones: A note on the Königs domain of compact composition operators on the Bl och space. Journal of Inequalities and Applications 2011 2011:31. Jones Journal of Inequalities and Applications ... Ω plays a complicated role in the behaviour of . We conclude this section by constructing a domain that displays very bad boundary properties. This answers a question of Madigan and Matheson ... Anderson, JM: Bloch Functions: The Basic Theory. Operators and Function Theory. D Reidel. 1–17 (1985) 2. Madigan, K, Matheson, A: Compact Composition Operators on the Bloch Space. Trans Am Math...
Ngày tải lên: 21/06/2014, 01:20
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
... conditions on the coefficients are given to guarantee that all the species are permanent. It is shown that these conditions are weaker than those of Liao et al. 2008. 1. Introduction Traditional ... exponentially for 2 ≤ i ≤ N, and u i t → X ∗ , where X ∗ is a certain solution of a logistic equation. Teng 8 and Ahmad and Stamova 9 also studied the coexistence on a nonautonomous Lotka-Volterra ... 4 Advances in Difference Equations 2. Proof of Theorem 1.2 The following lemma can be found in 10. Lemma 2.1. Assume that A& gt;0 and y0 > 0, and further suppose that (1) y n 1 ≤ Ay n ...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo toán học: "On eigenvalues in the essential spectrum of a Toeplitz operator " doc
Ngày tải lên: 05/08/2014, 15:21
Báo cáo toán học: "On the Domination Number of a Random Graph" docx
Ngày tải lên: 07/08/2014, 06:22
Báo cáo toán học: "On the h-Vector of a Lattice Path Matroid" pot
Ngày tải lên: 08/08/2014, 01:20