Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc

... massive accumulation of citrul- line in wild watermelon. As a first step to understand the mechanism of citrul- line and arginine accumulation in wild watermelon, we focused on the fifth step of citrulline ... cit- rulline and arginine. Results The enzyme involved in catalysis of the fifth step of citrulline biosynthesis in wild watermelon leaves During...

Ngày tải lên: 20/02/2014, 03:20

... CNBr-activated Sepharose 4B, bovine submaxillary mucin, porcine stomach mucin, bovine and porcine thyro- globulin, fetuin, transferrin, N-acetyl mannosamine, gluco- samine and galactosamine, lactose, glucose-6-phosphate, sucrose, ... lectin was sialic acid on the surface of erythrocytes. The binding specificity of crab lectin Inhibition studies with various sugars was helpful in dedu...

Ngày tải lên: 21/02/2014, 00:20

... vulgaris, and HybA, DmsB, and N rfC f rom E. coli. Some members, including AF499, have an N-terminal Ôtwin-arginineÕ signal sequence that is characteristic of cofactor-containing proteins translocated into ... contains an FAD-binding motif and four binding motifs for [4Fe-4S] clusters. HdrC contains two additional binding motifs for [4Fe-4S] clusters [2]. Hdr in t he two closely rel...

Ngày tải lên: 21/02/2014, 03:20

... seen in the putative T-box DNA-binding domain of t-bet, the STAT protein inter- action domain, STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger ... FOX proteins, a leucine zipper domain and a C2H2 zinc finger domain, both of which are thought to help mediate DNA binding and may be involved in the induction of dimer...

Ngày tải lên: 16/02/2014, 09:20

... representing the 5¢- and 3¢-UTRs are shown in white in the genomic gene and the cDNA. Intron size in bp, domain size in bp and domain size in amino acids are indicated at the bottom of each schematic ... address these interactions in in vitro and in vivo surrogate systems. In this study, protein interaction experiments have demonstrated that SmSmad1B and SmSmad1 sh...

Ngày tải lên: 18/02/2014, 16:20

... superimposed structures of conomarphin (red) and L-Phe13-conomarphin (gray). The side chain of L-Phe13 might cause spatial hindrance to the side chain of Lys9 and Hyp10 in forming the tight loop as in conomarphin. ... side chain of Lys9, Hyp10 and D-Phe13 of cono- marphin is shown in stick mode, and the side chain of L-Phe13 in L-Phe13-conomar- phin is shown as a g...

Ngày tải lên: 18/02/2014, 17:20

... the GHF9-cellulase possessing a family II CBM in the N-ter- minal region. By genomic PCR using specific primers to the 3¢-terminal coding sequences of HdEG66-cDNA, a DNA of 2186 bp including three introns was ... three cysteines are however present at residues 33, 58, and 90. In addition, a putative linker region rich in threonine and glycine residues locates in the position co...

Ngày tải lên: 20/02/2014, 23:20

... PstIandEcoRI in case of sipV or EcoRI-SacIincaseofsipW and ligated into corresponding sites of pUC18 DNA. The ligation mixes were used for PCR with oligo nucleotides Uni1 or Uni2 and pairs of ... TCNGCNGCNGCRTTRTTRTCNCCYTTNGT Cloning of sipW W7 TTGTGTAAAAGTGATGACATCGCC Cloning of sipW W8 GTGATCCCGATTATTCTGTGTGTT Cloning of sipW W9 GGCGATGTCATCACTTTTACACAA Cloning of sipW W...

Ngày tải lên: 21/02/2014, 03:20

... processing), and GmPDIL-1 and GmPDIL-2 associate with proglycinin and b-con- glycinin in the ER, suggesting that they may play important roles in folding and in formation and rearrangement of disulfide ... synthesis levels of both b-conglycinin and glycinin, as pro-b-conglycinin and proglycinin are transient pro- tein forms that are present in the ER prior to process-...

Ngày tải lên: 18/02/2014, 11:20

... observed in the presence of hep- arin (Fig. 6A) indicating that the mechanism of reiniti- ation operates in RNA synthesis using both the plus and the minus 3¢-ends of HCV RNA as templates. Finally, ... amount of radioactivity incorporated into the nucleic acids was measured after TCA precipitation and plotted against the incubation time in minutes. T. Astier-Gin et al. Bindi...

Ngày tải lên: 20/02/2014, 01:20