yet curiosity can kill a cat
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên :
02/11/2012, 11:12
... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... does an intestinal virus change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the viruses must adapt to environmental changes, able to withstand temperate, ... horses, seals, whales, and many types of birds as well as humans This can be a trans-species virus Type B infects only humans [8] Animals act as reservoirs for this influenza virus and Gelbalt [7]...
- 4
- 520
- 0
CCNA P3 V3 Configuring a Catalyst Switch
Ngày tải lên :
08/07/2013, 01:27
... has the lowest bridge ID, which is made up of the bridge’s priority and MAC address • With STP, ports transition through four states: blocking, listening, learning, and forwarding • If a change ... Systems, Inc All rights reserved ICND v2.0—3-14 Summary • STP is a bridge-to-bridge protocol used to maintain a loop-free network • STP establishes a root bridge, a root port, and designated ports ... topology, STP maintains connectivity by transitioning some blocked ports to the forwarding state • RSTP significantly speeds the recalculation of the spanning tree when the network topology changes ©...
- 16
- 324
- 0
Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch
Ngày tải lên :
16/10/2013, 21:15
... Switch#delete flash:vlan.dat Delete filename [vlan.dat]?[enter] Delete flash:vlan.dat? [confirm] [enter] If there was no VLAN file, this message is displayed %Error deleting flash:vlan.dat (No such ... hostname, access, and command mode passwords, as well as the management LAN settings These values are shown in the chart If problems occur while performing this configuration, refer to the Basic ... exit, and turn all the devices off Then remove and store the cables and adapter 3-4 CCNA 3: Switching Basics and Intermediate Routing v 3.0 - Lab 6.2.9 Copyright 2003, Cisco Systems, Inc Erasing...
- 4
- 337
- 0
Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study
Ngày tải lên :
18/10/2013, 12:15
... cycles, innovation streams, and ambidextrous organisations: organisational renewal through innovation streams and strategic change In Managing Strategic Innovation and Change, Tushman ML, Anderson ... essential part of the organization (Hedlund and Nonaka, 1993) McCartney (1998) states that `the activities that give rise to innovation are basically R McAdam Knowledge and Process Management RESEARCH ... disseminate and embody new knowledge far 236 Knowledge and Process Management beyond the organizational boundaries, leading to increased innovative partnerships and alliances (Nonaka and Takeuchi,...
- 9
- 498
- 2
Tài liệu NHỮNG SAI LẦM CẦN TRÁNH KHI CẮT GIẢM NHÂN SỰ TRONG THỜI KỲ KHỦNG HOẢNG KINH TẾ pptx
Ngày tải lên :
20/01/2014, 17:20
... đạo doanh nghiệp phải thể can đảm giữ cam kết cách gặp gỡ người bị sa thải, giúp họ chuyển đổi sang công việc mới, thể tinh thần bao dung, chia sẻ khó khăn Những nhân viên ch a bị sa thải quan sát ... phản ứng mạnh từ nhân viên, phòng ban bị sa thải họ ch a có chuẩn bị trước Do vậy, tốt nên đ a trước tín hiệu rõ ràng mức độ nghiêm trọng khó khăn tài mà doanh nghiệp phải đương đầu kế hoạch ... tình trạng kinh doanh sa sút, không sa thải, không hạ mức lương…, tức bạn tự giúp thân bạn Hãy khuyến khích tinh thần chinh phục niềm tin nhân viên giai đoạn khó khăn Công khai với nhân viên thực...
- 6
- 640
- 2
Tài liệu Lab 6.2.8 Password Recovery Procedure on a Catalyst 2900 Series Switches ppt
Ngày tải lên :
24/01/2014, 19:20
... Switch>enable Remove the VLAN database information file Switch#delete flash:vlan.dat Delete filename [vlan.dat]?[Enter] Delete flash:vlan.dat? [confirm] [Enter] If there was no VLAN file, this message ... host and switch configurations Step Reset the console password a Have a classmate change the console and VTY passwords on the switch Save the changes to the startup-config file and reload the ... is also applicable for those Catalyst 2800 switches that not have the Mode button in their front panel To recover a password, follow the steps below: Contact the Cisco TAC for the factory-installed...
- 7
- 327
- 0
Tài liệu Lab 6.2.8 Password Recovery Procedure on a Catalyst 2900 Series Switches docx
Ngày tải lên :
24/01/2014, 19:20
... existing password from Nonvolatile RAM (NVRAM) Note: If you type [N]o, the existing password remains valid Assign a password from the switch management interfaces (management console or Command Line ... below: Contact the Cisco TAC for the factory-installed password Provide the serial number and/or Media Access Control (MAC) address of the switch The serial number is usually located on the back of ... Switch#delete flash:vlan.dat Delete filename [vlan.dat]?[enter] Delete flash:vlan.dat? [confirm] [enter] If there was no VLAN file, this message is displayed %Error deleting flash:vlan.dat (No such...
- 6
- 326
- 0
Tài liệu Lab 6.2.9 Firmware Upgrade of a Catalyst 2900 Series Switch doc
Ngày tải lên :
24/01/2014, 19:20
... startup configuration from NVRAM #delete nvram This command resets the switch with factory defaults All system parameters will revert to their default factory settings All static and dynamic addresses ... enable If prompted for a password, enter class (if that does not work, ask the instructor) Switch>enable Remove the VLAN database information file Switch#delete flash:vlan.dat Delete filename ... be: Erase of nvram: complete Check that VLAN information was deleted Verify that the VLAN configuration was deleted in Step using the show vlan command If previous VLAN configuration information...
- 5
- 335
- 0
Tài liệu Cisco Systems - Configuring a catalyst switch pdf
Ngày tải lên :
17/02/2014, 08:20
... vlan VLAN Name Status Ports - default active Fa0/1, Fa0/2, Fa0/3, Fa0/4, Fa0/5, Fa0/6, Fa0/7, Fa0/8, Fa0/9, Fa0/10, Fa0/11, Fa0/12, Fa0/13, Fa0/14, Fa0/15, ... Subnet mask: 255.255.255.0 Default gateway: 10.5.5.3 Management VLAN: … wg_sw _a# Catalyst 2950 wg_sw_2950#show interface vlan Vlan1 is up, line protocol is up Hardware is Cat5 k Virtual Ethernet, address ... Adds, Moves, and Changes for MAC Addresses Adding a MAC Address Configure port security Configure the MAC address Changing a MAC Address Remove MAC address restrictions Moving a MAC Address Configure...
- 26
- 714
- 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt
Ngày tải lên :
19/02/2014, 12:20
... 3A3 –MP8 complex was assayed as a catalyst for the S-oxidation of thioanisole, the reaction conditions were optimized with MP8 alone acting as a catalyst For this purpose, thioanisole, 84 lM in ... S-oxidation of thioanisole As the above results showed that the best system for the S-oxidation of thioanisole associated H2O2 as an oxidant with MP8 as a catalyst in the presence of tBuOH as an ... best case, because an oxidative degradation of the catalyst occurred This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is characteristic...
- 7
- 447
- 0
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx
Ngày tải lên :
20/02/2014, 02:21
... (5¢-GAT AAAACCACACCTGTAGTAGCTG-3¢) and MCAD 116 5A G (5¢-CCTGTAGAAAGACTAATGAGGGATG CC-3¢) (mutagenic substitutions are shown in bold), and the antisense primer (5¢-GTAACGCCAGGGTTTTCCCA GTCAC-3¢) ... impact greatly on the catalytic activity, as the kcat and the ETF interaction are relatively unaffected This mutation seems to affect mainly the initial folding and stability of the tetramer, and ... disease-causing mutation and comparison with the normal enzyme Eur J Biochem 246, 548–556 15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Purification and characterization of short-chain, mediumchain,...
- 9
- 533
- 0
Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt
Ngày tải lên :
21/02/2014, 01:21
... phosphodiesterase (C) The analysis was performed by HPLC as indicated in Materials and methods The areas of the peaks corresponding to ATP (A and B) and AMP (C) were, in arbitrary units, 1243, 175 and 1265, ... shrimp alkaline phosphatase and phosphodiesterase as described in Materials and Methods and analyzed as above (Part B) Lane (– E): control without enzyme; lanes (C): complete reaction with no added ... 0.01 mM Ap 4A or Gp4G where indicated and other conditions as described in Materials and methods After 10 incubation at 30 °C, the reaction was stopped by heating at 90 °C, treated with alkaline...
- 7
- 475
- 0
20 ways to draw a cat and 44 other awesome animals
Ngày tải lên :
24/02/2014, 10:37
... example, have you ever heard of a capybara? A capybara is the largest rodent in the world That means it belongs to the same family as squirrels and bunnies, but it is as big as a dog! Even the same ... as many things as possible to decide what you like the best See how many different pictures you can come up with of your favorite animals How many ways can you draw a turtle shell? You can make ... Let’s learn how to draw animals together! There are few things more fascinating and beautiful on Earth than animals They come in all shapes and forms—from tiny birds to gigantic elephants, sweet...
- 97
- 971
- 0
THE TIPPING POINT How Little Things Can Make a Big Difference docx
Ngày tải lên :
05/03/2014, 20:20
... that little changes can somehow have big effects — is also a fairly radical notion We are, as humans, heavily socialized to make a kind of rough approximation between cause and effect If we want ... that Isaac Mizrahi was wearing the shoes himself," Lewis says "I think it's fair to say thai at the time we had no idea who Isaac Mizrahi was." By the fall of 1995, things began to happen in a ... stoops and park benches The drug trade ran so rampant and gang warfare was so ubiquitous in that part of Brooklyn that most people would take to the safety of their apartment at nightfall Police...
- 653
- 420
- 0
Báo cáo khoa học: Salt-resistant homodimeric bactenecin, a cathelicidin-derived antimicrobial peptide potx
Ngày tải lên :
07/03/2014, 06:20
... and Bac 2A, show similar activities against Gram-negative bacteria and stronger activities against Gram-positive bacteria [6], and Bac 2A also acts as a potent chemoattractant, inducing chemotaxis ... Salt-resistant homodimeric bactenecin J Y Lee et al antibacterial activity against both Gram-negative and certain Gram-positive bacteria [5] In addition, two linear variants of bactenecin, Bac2S ... we chemically synthesized two dimers that adopt parallel and antiparallel conformations and two monomers that adopt b-hairpin and linear conformations, and investigated their biological activities...
- 10
- 234
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
Ngày tải lên :
07/03/2014, 16:20
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT CLAP_2:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT...
- 12
- 772
- 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx
Ngày tải lên :
07/03/2014, 21:20
... little change At h of incubation (lane 3), the band of the b-subunit became very faint Some new bands between bands and became clearer and several bands around bands and also became darker The band ... HpU-9-L had a catalytic triad composed of Asp1, Ser2 7a and His93 These aminoacid residues were found at the identical locations in other catalytic antibodies such as VIPase, i41SL1-2 [14] and ECL2B ... catalytic dyad composed of His and Asp was important for the esterase activity of their catalytic anti-idiotypic antibody [27] In our case of HpU-9-H, no catalytic triad was observed as it lacked...
- 9
- 388
- 0
Báo cáo Y học: A catalytically inactive b1,4-N-acetylglucosaminyltransferase III (GnT-III) behaves as a dominant negative GnT-III inhibitor potx
Ngày tải lên :
08/03/2014, 16:20
... bisected sugar chains: 1, asialo-agalacto-bisected biantennary sugar chain; 2, asialo-agalactobisected tetraantennary sugar chain; 3, asialoagalacto-bisected triantennary sugar chain containing a b1,4-GlcNAc ... b1,4-GlcNAc residue on the Mana1,3 arm Arrowheads indicate nonbisected sugar chains: left arrowhead, overlapping peaks of asialo-agalacto biantennary and asialo-agalacto tetraantennary sugar chains; ... correlation with activities of a1 ,6,fucosyltransferase and N-acetylglucosaminyltransferases III and V Int J Cancer 8, 315±317 Ogawa, H., Kobayashi, I., Nagasaka, T., Namii, Y., Hayashi, S., Kadomatsu, K.,...
- 9
- 352
- 0